Incidental Mutation 'R5687:Crybg3'
ID443461
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
MMRRC Submission 043320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59559166 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 575 (M575T)
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172910
AA Change: M575T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Col11a1 T C 3: 114,217,103 probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Emc1 G T 4: 139,375,380 R950L probably damaging Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Lrrc47 A G 4: 154,015,683 T239A probably benign Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Nasp T A 4: 116,605,805 probably benign Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr1285 T C 2: 111,408,688 noncoding transcript Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zc3h13 A T 14: 75,331,960 R1416* probably null Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense not run
R7133:Crybg3 UTSW 16 59536804 missense not run
Predicted Primers PCR Primer
(F):5'- TCAAGGTGAAGAGGTGCCTC -3'
(R):5'- AGAAGTTACCTGCCCGAGAC -3'

Sequencing Primer
(F):5'- TCAGCATCAGAGGCAACG -3'
(R):5'- CGAGACTCGCAGAAAAATATGGTTTC -3'
Posted On2016-11-09