Incidental Mutation 'R5765:Slc17a6'
ID446228
Institutional Source Beutler Lab
Gene Symbol Slc17a6
Ensembl Gene ENSMUSG00000030500
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms2900073D12Rik, VGLUT2
MMRRC Submission 043366-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5765 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location51622006-51671119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51625501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 103 (T103A)
Ref Sequence ENSEMBL: ENSMUSP00000146364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032710
AA Change: T103A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500
AA Change: T103A

DomainStartEndE-ValueType
Pfam:MFS_1 76 461 6.5e-50 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207375
Predicted Effect possibly damaging
Transcript: ENSMUST00000207945
AA Change: T103A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208597
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,153,240 probably benign Het
4833423E24Rik T G 2: 85,484,194 probably null Het
Abcf2 T C 5: 24,573,423 R246G probably damaging Het
Adamts19 G T 18: 59,052,582 C1176F probably damaging Het
Adh7 G A 3: 138,226,329 V235I probably benign Het
Caprin2 G C 6: 148,843,168 P701A probably damaging Het
Casp7 T C 19: 56,433,883 V110A possibly damaging Het
Cd1d2 A T 3: 86,987,242 M106L probably benign Het
Cntnap2 C T 6: 46,529,815 probably benign Het
Cpm A G 10: 117,671,733 I252V probably benign Het
Dnaaf2 A C 12: 69,192,853 I631M probably damaging Het
Doxl2 C T 6: 48,978,537 P694S probably damaging Het
Fam117b A G 1: 59,970,472 probably null Het
Fbxw22 T C 9: 109,384,996 M251V probably benign Het
Fignl1 T C 11: 11,802,011 probably null Het
Foxp1 G A 6: 99,015,462 L156F probably damaging Het
Gdap1 A T 1: 17,161,426 M332L probably benign Het
H2-M3 T C 17: 37,272,443 F265S probably damaging Het
Il1rl1 C T 1: 40,461,943 A493V probably benign Het
Iqce A G 5: 140,666,140 S359P probably damaging Het
Kif2b C T 11: 91,577,242 E72K probably benign Het
Luzp1 T C 4: 136,541,029 S188P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mocs2 A G 13: 114,826,156 probably null Het
Mtnr1b T C 9: 15,863,163 Y200C probably damaging Het
Nalcn C T 14: 123,464,726 V458I possibly damaging Het
Nbea C T 3: 56,005,298 V1023I probably benign Het
Nbeal1 T A 1: 60,291,847 V2205D probably damaging Het
Nfe2l3 A G 6: 51,457,246 D262G probably damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Pcdhac1 A T 18: 37,090,319 R62* probably null Het
Pcdhga1 A G 18: 37,663,661 T573A probably benign Het
Plin4 C T 17: 56,102,470 C1276Y possibly damaging Het
Ppp6r1 C A 7: 4,642,208 R220L possibly damaging Het
Ptprz1 T G 6: 23,000,236 V775G probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Spock1 A T 13: 57,429,404 L404Q probably benign Het
Stradb C A 1: 58,992,744 H272N probably benign Het
Strn3 A G 12: 51,633,627 S397P probably benign Het
Synpo2l C T 14: 20,666,130 R126H possibly damaging Het
Tas2r104 A G 6: 131,685,273 Y158H probably benign Het
Tiparp T A 3: 65,531,350 I29N possibly damaging Het
Tnpo1 G A 13: 98,859,841 T484M probably benign Het
Tsc22d4 A G 5: 137,758,543 I78V probably benign Het
Ugt2b1 T C 5: 86,919,406 Y386C probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Vmn2r116 G A 17: 23,401,404 C704Y probably damaging Het
Vmn2r97 T A 17: 18,947,180 Y565* probably null Het
Zfand2b T A 1: 75,170,527 probably null Het
Zzef1 C T 11: 72,821,937 Q228* probably null Het
Other mutations in Slc17a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Slc17a6 APN 7 51669115 missense probably benign 0.15
IGL01653:Slc17a6 APN 7 51668022 missense possibly damaging 0.92
IGL01993:Slc17a6 APN 7 51667957 missense possibly damaging 0.51
IGL02082:Slc17a6 APN 7 51669029 missense probably benign 0.00
IGL02212:Slc17a6 APN 7 51667470 missense possibly damaging 0.94
IGL02544:Slc17a6 APN 7 51666155 nonsense probably null
IGL02585:Slc17a6 APN 7 51625349 missense probably benign 0.00
IGL03206:Slc17a6 APN 7 51666023 splice site probably benign
IGL03396:Slc17a6 APN 7 51669092 missense probably damaging 1.00
R0137:Slc17a6 UTSW 7 51666144 missense probably benign 0.00
R0141:Slc17a6 UTSW 7 51669067 missense probably benign 0.10
R0207:Slc17a6 UTSW 7 51646180 intron probably benign
R0362:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R0841:Slc17a6 UTSW 7 51625315 missense probably benign 0.29
R1037:Slc17a6 UTSW 7 51649248 splice site probably benign
R1325:Slc17a6 UTSW 7 51661552 missense probably benign 0.15
R1614:Slc17a6 UTSW 7 51646277 intron probably benign
R1625:Slc17a6 UTSW 7 51661460 missense probably benign 0.00
R1736:Slc17a6 UTSW 7 51661585 splice site probably benign
R1777:Slc17a6 UTSW 7 51646209 missense possibly damaging 0.63
R1824:Slc17a6 UTSW 7 51661546 missense probably damaging 1.00
R2249:Slc17a6 UTSW 7 51667906 missense probably damaging 1.00
R4283:Slc17a6 UTSW 7 51645076 missense probably damaging 1.00
R4910:Slc17a6 UTSW 7 51658741 missense possibly damaging 0.78
R5301:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R5523:Slc17a6 UTSW 7 51626850 nonsense probably null
R5570:Slc17a6 UTSW 7 51658756 missense probably benign 0.00
R5720:Slc17a6 UTSW 7 51625397 missense probably damaging 1.00
R5736:Slc17a6 UTSW 7 51645093 missense possibly damaging 0.78
R6380:Slc17a6 UTSW 7 51667463 missense probably benign 0.02
R6989:Slc17a6 UTSW 7 51661476 missense possibly damaging 0.88
R7178:Slc17a6 UTSW 7 51667511 missense possibly damaging 0.58
R7194:Slc17a6 UTSW 7 51626892 missense probably damaging 1.00
R7325:Slc17a6 UTSW 7 51645018 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTAATCCGACACAGGGTGC -3'
(R):5'- AATTGCACTCTGGTTGTCCG -3'

Sequencing Primer
(F):5'- CGAGAGACCATCGAGCTGAC -3'
(R):5'- TGTCCGATCTAGGATGACAGTCC -3'
Posted On2016-11-21