Incidental Mutation 'R4966:Nup210l'
ID446659
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Namenucleoporin 210-like
Synonyms4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission 042562-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4966 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90104132-90212048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90106901 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 65 (H65R)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: H65R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: H65R

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: H65R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: H65R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 96% (94/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
Abcb5 T A 12: 118,886,891 probably benign Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Actn1 T C 12: 80,173,130 I656V probably benign Het
Arhgef15 A G 11: 68,947,317 V659A probably benign Het
AW551984 T C 9: 39,597,176 E348G possibly damaging Het
Bbs2 A T 8: 94,080,807 V453E probably damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cyld A G 8: 88,742,301 I567V possibly damaging Het
Dact3 G C 7: 16,886,088 V503L unknown Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drc7 G A 8: 95,071,596 E490K probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Fgfr1 C A 8: 25,572,445 Y665* probably null Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gpr45 A G 1: 43,033,120 T308A probably benign Het
Grm1 T A 10: 10,719,665 K740* probably null Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ino80c T C 18: 24,106,645 D153G probably damaging Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Myo9a A G 9: 59,871,734 D1591G probably benign Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nlgn1 C T 3: 25,920,237 G165D possibly damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Nup205 G A 6: 35,243,849 R1862H probably benign Het
Olfr1388 A G 11: 49,444,118 D89G possibly damaging Het
Olfr827 A T 10: 130,210,437 M231K probably benign Het
Pcmtd1 C A 1: 7,161,009 Y176* probably null Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rdx T C 9: 52,075,009 V372A probably benign Het
Reep6 T A 10: 80,333,799 F107Y probably benign Het
Rere G T 4: 150,613,816 probably benign Het
Rmdn2 G T 17: 79,666,875 A266S probably damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Rnpepl1 A T 1: 92,916,761 N325I probably damaging Het
Rps6ka5 T A 12: 100,553,066 M763L probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3j T A 12: 104,319,784 C399* probably null Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sim2 T C 16: 94,123,421 V475A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Snrnp25 A G 11: 32,207,595 K58E probably damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tm2d3 A G 7: 65,697,721 N101S possibly damaging Het
Tmem201 G T 4: 149,718,687 Q575K probably benign Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trak2 G A 1: 58,919,321 T267I probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Vmn2r67 A T 7: 85,136,385 V804E probably damaging Het
Wdr81 T A 11: 75,445,949 Q1538L probably benign Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Zmat4 T C 8: 23,902,069 S83P probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 intron probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCCTATTTTAAACATCGTGGGAG -3'
(R):5'- TGGCCACAGGAACCAATGAG -3'

Sequencing Primer
(F):5'- CTTTGCACAAGTGATCATTGGGAAG -3'
(R):5'- CAGGAACCAATGAGTCAAATTCC -3'
Posted On2016-12-12