Mutagenetix > Incidental Mutations

Incidental Mutation 'R0332:Nup210l'

35909

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

038541-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R0332 (G1)

Quality Score

206

Status

Validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 90132309 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

Predicted Effect

probably benign
Transcript: ENSMUST00000029548

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200410

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	T	17: 23,714,604		probably benign	Het
Aggf1	T	C	13: 95,369,446	E211G	probably damaging	Het
Aox3	A	G	1: 58,142,751	N299S	probably benign	Het
Arhgef7	T	A	8: 11,824,701	Y777*	probably null	Het
Atad1	A	G	19: 32,702,534		probably benign	Het
Bop1	A	G	15: 76,455,987	Y130H	probably damaging	Het
Ccar2	G	T	14: 70,141,935		probably benign	Het
Ccdc110	G	T	8: 45,942,964	E631*	probably null	Het
Cfap54	C	T	10: 93,035,457	D634N	probably damaging	Het
Cldn8	C	T	16: 88,562,358		silent	Het
Cstf3	G	T	2: 104,646,467		probably null	Het
Dgkq	T	C	5: 108,655,099		probably benign	Het
Dsp	T	A	13: 38,182,228	L546*	probably null	Het
Eif3g	A	T	9: 20,897,984		probably benign	Het
Fam228a	T	A	12: 4,735,018	I38F	probably damaging	Het
Fto	A	T	8: 91,401,890		probably benign	Het
Gcnt4	G	T	13: 96,946,510	V105L	probably benign	Het
Gm10644	A	G	8: 83,933,581	L45S	possibly damaging	Het
Gm7275	A	T	16: 48,073,769		noncoding transcript	Het
Gm7579	T	C	7: 142,212,375	S173P	unknown	Het
Gpatch8	T	C	11: 102,481,842	N290S	unknown	Het
Hspb8	T	A	5: 116,409,473	D150V	probably damaging	Het
Ifitm1	T	C	7: 140,968,453		probably benign	Het
Ifnl2	T	C	7: 28,509,331	T99A	possibly damaging	Het
Ints4	T	C	7: 97,517,718	L577P	probably damaging	Het
Jph4	T	C	14: 55,114,010	E183G	possibly damaging	Het
Loxhd1	T	A	18: 77,383,830		probably null	Het
Mug1	G	A	6: 121,849,897		probably null	Het
Nlrp2	C	A	7: 5,317,630	C836F	probably damaging	Het
Olfr18	A	G	9: 20,314,056	L288S	probably benign	Het
Olfr555	A	T	7: 102,659,465	I215F	probably damaging	Het
Optn	C	T	2: 5,024,115	G526R	probably damaging	Het
Phykpl	A	G	11: 51,586,675	E98G	probably benign	Het
Pikfyve	A	G	1: 65,264,399	N1648D	probably benign	Het
Plppr5	A	T	3: 117,671,932	R277S	probably benign	Het
Ppp1r36	T	A	12: 76,427,903	F86L	probably benign	Het
Pqlc2	C	T	4: 139,300,299	S244N	possibly damaging	Het
Ptgis	A	T	2: 167,214,833	L278Q	probably damaging	Het
Rasa2	A	T	9: 96,606,176	F90Y	probably damaging	Het
Setd3	T	C	12: 108,107,579	K480E	probably benign	Het
Snx2	T	C	18: 53,212,911	F389L	probably benign	Het
Sulf2	G	A	2: 166,089,199	T296M	probably benign	Het
Supt16	A	T	14: 52,181,157	H214Q	probably damaging	Het
Tbx4	A	T	11: 85,898,530	M12L	probably benign	Het
Tlk1	A	T	2: 70,745,565		probably null	Het
Tmprss7	C	T	16: 45,680,638	V267M	probably benign	Het
Tmub2	G	A	11: 102,288,348	R291H	probably damaging	Het
Trpm2	A	T	10: 77,947,988	V217E	probably damaging	Het
Try10	T	A	6: 41,354,220	V10E	probably benign	Het
Ttn	A	G	2: 76,765,882	V20229A	probably benign	Het
Ttn	A	C	2: 76,778,194		probably null	Het
Uhrf1bp1	T	C	17: 27,893,294		probably null	Het
Usf2	T	A	7: 30,955,179	M199L	possibly damaging	Het
Usp37	A	T	1: 74,495,710	S26T	possibly damaging	Het
Vrk1	G	C	12: 106,058,625	Q253H	probably benign	Het
Wdr72	A	T	9: 74,157,252		probably null	Het
Xrra1	T	C	7: 99,876,242	F123L	probably damaging	Het
Zfhx3	T	C	8: 108,946,623	I1435T	probably damaging	Het
Zfp712	T	A	13: 67,040,813	H550L	probably damaging	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	intron	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GAAGTAAGATCTGTCCTGAGCGCC -3'
(R):5'- TTCTGCCACACAGCCAGATGAC -3'

Sequencing Primer
(F):5'- TAGCTATGCATTTAAGGGATGAAGAC -3'
(R):5'- gcacacacacctgaaatcc -3'

Posted On

2013-05-09