Incidental Mutation 'R5838:Drc1'
ID449711
Institutional Source Beutler Lab
Gene Symbol Drc1
Ensembl Gene ENSMUSG00000073102
Gene Namedynein regulatory complex subunit 1
SynonymsCcdc164, Gm1060, LOC381738, b2b1654Clo
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30281388-30366695 bp(+) (GRCm38)
Type of Mutationunclassified (549 bp from exon)
DNA Base Change (assembly) T to A at 30366513 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]
Predicted Effect probably null
Transcript: ENSMUST00000074171
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101448
AA Change: I742N

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102
AA Change: I742N

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
Pfam:NYD-SP28 100 200 1.7e-33 PFAM
coiled coil region 280 318 N/A INTRINSIC
low complexity region 455 473 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
low complexity region 599 612 N/A INTRINSIC
Pfam:NYD-SP28_assoc 673 732 2.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114747
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200001
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central component of the nexin-dynein complex (N-DRC), which regulates the assembly of ciliary dynein. Mutations in this gene can cause ciliary dyskinesia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit heterotaxy with complex congenital heart disease such as transposition of the great arteries (TGA), atrioventricular septal defects (AVSD), and vein abnormalities; immotile/dyskinetic airway cilia are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Drc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Drc1 APN 5 30345663 missense probably damaging 1.00
IGL02123:Drc1 APN 5 30347104 missense probably benign 0.07
IGL02839:Drc1 APN 5 30350423 missense probably benign 0.02
putative UTSW 5 30356288 missense probably benign 0.11
PIT4431001:Drc1 UTSW 5 30347073 missense probably damaging 0.98
R0147:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0148:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0590:Drc1 UTSW 5 30363136 missense probably benign 0.00
R1640:Drc1 UTSW 5 30363957 missense possibly damaging 0.81
R1799:Drc1 UTSW 5 30366497 missense probably damaging 1.00
R2105:Drc1 UTSW 5 30356441 missense probably benign 0.01
R2252:Drc1 UTSW 5 30342731 missense probably benign 0.00
R2366:Drc1 UTSW 5 30366550 makesense probably null
R2570:Drc1 UTSW 5 30355265 missense probably damaging 1.00
R4036:Drc1 UTSW 5 30347182 missense probably benign
R4181:Drc1 UTSW 5 30355713 missense probably benign 0.16
R4210:Drc1 UTSW 5 30347146 missense possibly damaging 0.47
R4329:Drc1 UTSW 5 30355658 missense probably benign 0.16
R4560:Drc1 UTSW 5 30363097 missense probably benign
R4765:Drc1 UTSW 5 30348731 missense probably benign 0.04
R5239:Drc1 UTSW 5 30363123 missense probably benign 0.00
R5375:Drc1 UTSW 5 30356401 missense probably benign
R5933:Drc1 UTSW 5 30345529 missense probably damaging 0.99
R6014:Drc1 UTSW 5 30345649 missense probably damaging 1.00
R6408:Drc1 UTSW 5 30356288 missense probably benign 0.11
R6710:Drc1 UTSW 5 30363085 missense possibly damaging 0.83
R6755:Drc1 UTSW 5 30355146 missense probably damaging 1.00
R7341:Drc1 UTSW 5 30364468 missense probably damaging 1.00
X0018:Drc1 UTSW 5 30345544 missense probably damaging 1.00
X0021:Drc1 UTSW 5 30356423 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GAGAATGCTTCTGGGAGCACTAG -3'
(R):5'- GGCCTCTTTCACAGCATTCAG -3'

Sequencing Primer
(F):5'- CACTAGCTGGAGCCAGACAG -3'
(R):5'- TCAGAAAAACCCAGGGTG -3'
Posted On2016-12-20