Incidental Mutation 'R5898:Sept2'
ID457622
Institutional Source Beutler Lab
Gene Symbol Sept2
Ensembl Gene ENSMUSG00000026276
Gene Nameseptin 2
SynonymsNedd5
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R5898 (G1)
Quality Score91
Status Validated
Chromosome1
Chromosomal Location93478964-93510260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93479301 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 20 (D20A)
Ref Sequence ENSEMBL: ENSMUSP00000121974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027495] [ENSMUST00000112912] [ENSMUST00000129211] [ENSMUST00000131175] [ENSMUST00000136182] [ENSMUST00000142401] [ENSMUST00000149532] [ENSMUST00000150931] [ENSMUST00000153826] [ENSMUST00000168776] [ENSMUST00000170883] [ENSMUST00000172165] [ENSMUST00000179353] [ENSMUST00000188165] [ENSMUST00000189025]
Predicted Effect probably benign
Transcript: ENSMUST00000027495
SMART Domains Protein: ENSMUSP00000027495
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112912
SMART Domains Protein: ENSMUSP00000108534
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129211
SMART Domains Protein: ENSMUSP00000120511
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 213 4.9e-85 PFAM
Pfam:AIG1 38 131 9.9e-7 PFAM
Pfam:MMR_HSR1 39 211 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131175
SMART Domains Protein: ENSMUSP00000120694
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 212 6.5e-85 PFAM
Pfam:AIG1 38 131 9.8e-7 PFAM
Pfam:MMR_HSR1 39 211 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136182
SMART Domains Protein: ENSMUSP00000118621
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:AIG1 1 96 1.4e-6 PFAM
Pfam:MMR_HSR1 1 103 1.3e-8 PFAM
Pfam:Septin 1 107 6.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142401
AA Change: D20A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121974
Gene: ENSMUSG00000026276
AA Change: D20A

DomainStartEndE-ValueType
Pfam:Septin 64 177 4.9e-49 PFAM
Pfam:AIG1 68 159 2.3e-7 PFAM
Pfam:MMR_HSR1 69 172 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149532
SMART Domains Protein: ENSMUSP00000115536
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 120 7e-35 PFAM
Pfam:GTP_EFTU 37 110 9.5e-6 PFAM
Pfam:AIG1 38 120 3.4e-7 PFAM
Pfam:Ras 39 115 1.2e-5 PFAM
Pfam:MMR_HSR1 39 118 2.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150931
SMART Domains Protein: ENSMUSP00000117517
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152778
Predicted Effect probably benign
Transcript: ENSMUST00000153826
SMART Domains Protein: ENSMUSP00000114614
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 77 4.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168776
SMART Domains Protein: ENSMUSP00000132850
Gene: ENSMUSG00000116048

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.4e-129 PFAM
Pfam:MMR_HSR1 39 240 1.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170883
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172165
SMART Domains Protein: ENSMUSP00000127276
Gene: ENSMUSG00000116048

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 203 5.8e-8 PFAM
Pfam:Septin 1 273 1.5e-125 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179353
SMART Domains Protein: ENSMUSP00000136366
Gene: ENSMUSG00000116048

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188923
Predicted Effect probably benign
Transcript: ENSMUST00000189025
SMART Domains Protein: ENSMUSP00000140399
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
Blast:KH 74 130 2e-20 BLAST
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Adsl A G 15: 80,961,353 probably null Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fap A T 2: 62,573,503 F9L probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pcdhb8 T A 18: 37,357,484 D738E possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Rcbtb2 T A 14: 73,161,965 L23* probably null Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc22a5 T A 11: 53,873,733 I296F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbrg4 T C 11: 6,617,372 D576G probably damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Sept2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Sept2 APN 1 93499142 missense probably damaging 1.00
IGL01909:Sept2 APN 1 93499101 missense probably damaging 1.00
IGL02504:Sept2 APN 1 93500481 missense probably benign 0.06
R0136:Sept2 UTSW 1 93507050 missense possibly damaging 0.57
R0140:Sept2 UTSW 1 93501639 missense probably damaging 1.00
R0335:Sept2 UTSW 1 93495599 missense probably damaging 1.00
R0538:Sept2 UTSW 1 93501623 missense probably damaging 1.00
R1370:Sept2 UTSW 1 93499106 missense probably damaging 1.00
R1463:Sept2 UTSW 1 93499315 missense possibly damaging 0.79
R4832:Sept2 UTSW 1 93499127 missense probably damaging 0.98
R5443:Sept2 UTSW 1 93497452 missense possibly damaging 0.95
R5845:Sept2 UTSW 1 93499035 unclassified probably null
R6122:Sept2 UTSW 1 93497376 missense probably damaging 1.00
R6542:Sept2 UTSW 1 93497466 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGAGAAAGGGCTAGAGTTCTG -3'
(R):5'- TGTCACTGCCTTAAATTGGGG -3'

Sequencing Primer
(F):5'- GCTAGAGTTCTGCCCTCGC -3'
(R):5'- GGAACTTCATTAACATCCCAGGGTG -3'
Posted On2017-02-15