Incidental Mutation 'R5931:Ermp1'
ID461885
Institutional Source Beutler Lab
Gene Symbol Ermp1
Ensembl Gene ENSMUSG00000046324
Gene Nameendoplasmic reticulum metallopeptidase 1
SynonymsD19Ertd410e, D19Wsu12e
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29608214-29648415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 29615729 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 788 (A788P)
Ref Sequence ENSEMBL: ENSMUSP00000124881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054083] [ENSMUST00000159692] [ENSMUST00000162534]
Predicted Effect probably benign
Transcript: ENSMUST00000054083
SMART Domains Protein: ENSMUSP00000057069
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
SCOP:d1amp__ 31 159 3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159692
AA Change: A788P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124881
Gene: ENSMUSG00000046324
AA Change: A788P

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 65 94 N/A INTRINSIC
Pfam:Peptidase_M28 179 373 1.3e-49 PFAM
Pfam:Peptidase_M20 184 375 2.9e-8 PFAM
transmembrane domain 405 427 N/A INTRINSIC
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 481 503 N/A INTRINSIC
transmembrane domain 516 538 N/A INTRINSIC
transmembrane domain 543 562 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161749
Predicted Effect probably benign
Transcript: ENSMUST00000162534
SMART Domains Protein: ENSMUSP00000124992
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
Pfam:Peptidase_M28 5 176 2.4e-40 PFAM
Pfam:Peptidase_M20 8 168 1.3e-8 PFAM
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 257 279 N/A INTRINSIC
transmembrane domain 294 316 N/A INTRINSIC
transmembrane domain 329 351 N/A INTRINSIC
transmembrane domain 356 375 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including double outlet right ventricle, aortic arch anomalies and vascular ring, as well as anopthalmia, renal dysplasia, and craniofacial anomalies including short snout, cleft palate and cleft lip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Ermp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Ermp1 APN 19 29639939 missense probably damaging 1.00
IGL01696:Ermp1 APN 19 29646138 missense possibly damaging 0.65
IGL01759:Ermp1 APN 19 29615836 missense probably benign 0.03
IGL01891:Ermp1 APN 19 29616602 missense probably benign 0.16
IGL02008:Ermp1 APN 19 29612920 missense probably damaging 1.00
IGL02034:Ermp1 APN 19 29645959 splice site probably benign
IGL02655:Ermp1 APN 19 29646210 nonsense probably null
IGL03074:Ermp1 APN 19 29612535 missense probably damaging 1.00
PIT4366001:Ermp1 UTSW 19 29628789 missense probably benign 0.24
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0361:Ermp1 UTSW 19 29631406 missense probably damaging 1.00
R0684:Ermp1 UTSW 19 29632541 splice site probably benign
R0711:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R1167:Ermp1 UTSW 19 29628679 missense possibly damaging 0.53
R1869:Ermp1 UTSW 19 29646015 missense possibly damaging 0.66
R1884:Ermp1 UTSW 19 29616679 missense probably benign 0.00
R2094:Ermp1 UTSW 19 29639928 missense probably benign 0.09
R2135:Ermp1 UTSW 19 29646065 missense possibly damaging 0.81
R2153:Ermp1 UTSW 19 29637398 critical splice acceptor site probably null
R2290:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R4176:Ermp1 UTSW 19 29645965 critical splice donor site probably null
R4363:Ermp1 UTSW 19 29612876 missense probably damaging 1.00
R4579:Ermp1 UTSW 19 29616651 missense probably damaging 0.98
R4761:Ermp1 UTSW 19 29646256 missense probably benign 0.03
R5801:Ermp1 UTSW 19 29612828 missense probably damaging 1.00
R6129:Ermp1 UTSW 19 29623209 missense possibly damaging 0.95
R6556:Ermp1 UTSW 19 29612921 missense possibly damaging 0.91
R6563:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R6598:Ermp1 UTSW 19 29632502 missense possibly damaging 0.82
R6647:Ermp1 UTSW 19 29626935 missense probably benign 0.27
R6850:Ermp1 UTSW 19 29616641 missense probably damaging 1.00
R6912:Ermp1 UTSW 19 29616611 missense probably benign 0.02
R7341:Ermp1 UTSW 19 29646254 missense probably benign 0.20
R7391:Ermp1 UTSW 19 29627068 critical splice acceptor site probably null
R7391:Ermp1 UTSW 19 29627069 critical splice acceptor site probably null
R7463:Ermp1 UTSW 19 29646262 nonsense probably null
R7471:Ermp1 UTSW 19 29612654 missense probably benign 0.06
Z1088:Ermp1 UTSW 19 29612925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTCACCCTGTAAGTTTTGC -3'
(R):5'- GGAATTTGCTGTCAGCTGC -3'

Sequencing Primer
(F):5'- AGTGACAGTGCATGGCTC -3'
(R):5'- GAATTTGCTGTCAGCTGCTAAAG -3'
Posted On2017-02-28