Incidental Mutation 'R0570:Rnf130'
ID46395
Institutional Source Beutler Lab
Gene Symbol Rnf130
Ensembl Gene ENSMUSG00000020376
Gene Namering finger protein 130
SynonymsG1RZFP, G1RP, 2510042A13Rik
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50025346-50104758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50095876 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 349 (D349V)
Ref Sequence ENSEMBL: ENSMUSP00000099837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054684] [ENSMUST00000102776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054684
AA Change: D349V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056345
Gene: ENSMUSG00000020376
AA Change: D349V

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 65 169 4.6e-13 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102776
AA Change: D349V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099837
Gene: ENSMUSG00000020376
AA Change: D349V

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 69 167 8.1e-14 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143607
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Rnf130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Rnf130 APN 11 50093796 missense probably damaging 1.00
IGL02364:Rnf130 APN 11 50095840 missense probably benign
IGL02948:Rnf130 APN 11 50052771 splice site probably benign
R0145:Rnf130 UTSW 11 50071219 missense possibly damaging 0.89
R0358:Rnf130 UTSW 11 50071282 missense probably benign 0.01
R0786:Rnf130 UTSW 11 50087437 missense probably damaging 1.00
R1709:Rnf130 UTSW 11 50087386 missense possibly damaging 0.80
R2312:Rnf130 UTSW 11 50087463 critical splice donor site probably null
R2972:Rnf130 UTSW 11 50093800 nonsense probably null
R4353:Rnf130 UTSW 11 50087440 missense possibly damaging 0.83
R4398:Rnf130 UTSW 11 50071378 missense probably benign 0.08
R5162:Rnf130 UTSW 11 50052895 missense probably damaging 1.00
R5236:Rnf130 UTSW 11 50095978 missense probably damaging 0.99
R5869:Rnf130 UTSW 11 50085815 splice site probably null
R6432:Rnf130 UTSW 11 50095790 nonsense probably null
R6865:Rnf130 UTSW 11 50071264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGTACATGACATCAGCCTCCC -3'
(R):5'- TCCTTTACAAAACTGCTGGACCACG -3'

Sequencing Primer
(F):5'- ACAGTAGTCTCCTTTGCCAAG -3'
(R):5'- AACTTTCTTCTTGCAGTCATCAG -3'
Posted On2013-06-11