Incidental Mutation 'R6021:Brix1'
ID478964
Institutional Source Beutler Lab
Gene Symbol Brix1
Ensembl Gene ENSMUSG00000022247
Gene NameBRX1, biogenesis of ribosomes
Synonyms1110064N10Rik, Bxdc2
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6021 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10474779-10485947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10476589 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 267 (R267H)
Ref Sequence ENSEMBL: ENSMUSP00000022855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000168761] [ENSMUST00000169050]
Predicted Effect probably benign
Transcript: ENSMUST00000022855
AA Change: R267H

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247
AA Change: R267H

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169050
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Brix1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03136:Brix1 APN 15 10478766 missense probably damaging 0.97
R1266:Brix1 UTSW 15 10478761 missense probably damaging 1.00
R4276:Brix1 UTSW 15 10481747 missense possibly damaging 0.60
R4320:Brix1 UTSW 15 10483312 missense probably damaging 1.00
R4824:Brix1 UTSW 15 10485742 missense possibly damaging 0.90
R4902:Brix1 UTSW 15 10483292 splice site probably null
R6018:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6019:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6022:Brix1 UTSW 15 10476589 missense probably benign 0.26
R7203:Brix1 UTSW 15 10483292 splice site probably null
R7218:Brix1 UTSW 15 10483292 splice site probably null
X0023:Brix1 UTSW 15 10478686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCTCTGGTTTCACCCAC -3'
(R):5'- CCAAACATGGTAAGCTGGGG -3'

Sequencing Primer
(F):5'- GGTTTCACCCACTGTATTTCTACTGG -3'
(R):5'- CAAACATGGTAAGCTGGGGGTTTTAG -3'
Posted On2017-06-26