Incidental Mutation 'R6110:Vldlr'
ID484815
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27238077 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 117 (E117G)
Ref Sequence ENSEMBL: ENSMUSP00000049145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025866
AA Change: E158G

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: E158G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000047645
AA Change: E117G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: E117G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably benign
Transcript: ENSMUST00000164746
SMART Domains Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 69 1.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167487
AA Change: E158G

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: E158G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172302
AA Change: E158G

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: E158G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCTCAATATAACAGCACTGTAGC -3'
(R):5'- ACTGCTCAAGAGACTCGTCTG -3'

Sequencing Primer
(F):5'- GCACTGTAGCTTTACAATTAGAAAGC -3'
(R):5'- AAGAGACTCGTCTGATTGGTCTGAAC -3'
Posted On2017-08-16