Incidental Mutation 'R6135:Cldn16'
ID488317
Institutional Source Beutler Lab
Gene Symbol Cldn16
Ensembl Gene ENSMUSG00000038148
Gene Nameclaudin 16
SynonymsPCLN1, claudin-16, paracellin-1
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location26463135-26482765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26474268 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 65 (D65N)
Ref Sequence ENSEMBL: ENSMUSP00000124528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115302] [ENSMUST00000161053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115302
AA Change: D65N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110957
Gene: ENSMUSG00000038148
AA Change: D65N

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 183 2.1e-20 PFAM
Pfam:Claudin_2 14 185 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161053
AA Change: D65N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124528
Gene: ENSMUSG00000038148
AA Change: D65N

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 183 2.2e-20 PFAM
Pfam:Claudin_2 14 185 1.2e-12 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is critical for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in the thick ascending loop of Henle. The gene deficiency leads to specific alterations in renal Ca(2+) and Mg(2+) balance and also to disturbances in Na(+) handling. The interaction of this gene and the Cldn 19 gene is required for their assembly into tight junctions and for renal Mg(2+) reabsorption. This gene and the Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display an age-dependent progressive phenotype that includes hypercalciuria and hypomagnesemia, significantly elevated serum parathyroid hormone and calcitriol (1,25(OH)2D3) levels, and a significantly lower urinary pH but no nephrocalcinosis or renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Cldn16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Cldn16 APN 16 26482546 nonsense probably null
R1469:Cldn16 UTSW 16 26474180 splice site probably benign
R3620:Cldn16 UTSW 16 26477552 missense possibly damaging 0.73
R4586:Cldn16 UTSW 16 26477558 missense probably benign 0.00
R6257:Cldn16 UTSW 16 26481330 missense probably damaging 0.96
R6818:Cldn16 UTSW 16 26477507 missense probably damaging 1.00
R7129:Cldn16 UTSW 16 26482638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTGTAACCACTGTACTTTG -3'
(R):5'- AAGATATTGTGTAAAGTCCCTTGTG -3'

Sequencing Primer
(F):5'- TTGATAACAAACATACCTGAGTGACC -3'
(R):5'- TTTGCAAAATCAGGAGGAACG -3'
Posted On2017-10-10