Incidental Mutation 'R0530:Olfr1417'
ID49128
Institutional Source Beutler Lab
Gene Symbol Olfr1417
Ensembl Gene ENSMUSG00000048292
Gene Nameolfactory receptor 1417
SynonymsGA_x6K02T2RE5P-2172809-2171862, MOR266-2
MMRRC Submission 038722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0530 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11826803-11839219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11828192 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 278 (V278A)
Ref Sequence ENSEMBL: ENSMUSP00000149141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061235] [ENSMUST00000214887]
Predicted Effect probably benign
Transcript: ENSMUST00000061235
AA Change: V278A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062542
Gene: ENSMUSG00000048292
AA Change: V278A

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.3e-53 PFAM
Pfam:7tm_1 41 291 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213141
Predicted Effect probably benign
Transcript: ENSMUST00000214887
AA Change: V278A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,530,120 noncoding transcript Het
Abcg3 A G 5: 104,936,054 W617R probably damaging Het
Cep83 A T 10: 94,719,588 probably benign Het
Ces1e G A 8: 93,219,521 probably benign Het
Ckap2 A G 8: 22,175,972 probably benign Het
Clip1 C A 5: 123,640,531 R443L probably damaging Het
Clmp A G 9: 40,761,006 D44G probably benign Het
Cntnap2 G A 6: 46,529,905 Q304* probably null Het
Cst7 A T 2: 150,570,515 probably benign Het
Dclk3 A T 9: 111,482,721 Y677F probably damaging Het
Dlat G T 9: 50,637,569 N562K probably damaging Het
Elmod1 A T 9: 53,925,976 Y182N probably damaging Het
Fam19a3 T C 3: 104,772,171 probably benign Het
Fzd10 T C 5: 128,602,013 F266L probably damaging Het
Gm5346 A T 8: 43,626,531 C219S probably benign Het
Gm7534 A G 4: 134,202,910 I28T probably benign Het
Gm8258 A G 5: 104,776,086 noncoding transcript Het
Gm9742 T A 13: 8,030,005 noncoding transcript Het
Hdlbp T C 1: 93,430,317 probably benign Het
Itga8 A G 2: 12,191,816 S597P probably damaging Het
Kndc1 A T 7: 139,901,237 I80F probably damaging Het
Ktn1 A G 14: 47,733,243 N1192S probably benign Het
Ldha G A 7: 46,853,993 V270M probably damaging Het
Lyst T C 13: 13,757,306 probably benign Het
Map3k9 A T 12: 81,722,482 F954I probably benign Het
Mroh2b A G 15: 4,934,395 N823S probably damaging Het
Mycbp2 A T 14: 103,182,459 N2480K probably damaging Het
Nat1 A G 8: 67,491,325 K121E probably benign Het
Neurl1b T A 17: 26,441,545 probably null Het
Nnt C A 13: 119,394,721 L163F probably damaging Het
Otog A G 7: 46,298,244 T2274A probably damaging Het
Pde4b G A 4: 102,602,651 R561Q probably damaging Het
Pitpnm2 A G 5: 124,131,201 F453L probably damaging Het
Pms1 T C 1: 53,196,813 probably null Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Prdx6b A G 2: 80,293,315 N156S probably damaging Het
Ptpn9 A G 9: 57,061,133 S586G probably benign Het
Serpina6 A T 12: 103,651,794 N253K probably damaging Het
Slc12a2 T A 18: 57,919,536 V809D possibly damaging Het
Slc2a8 C T 2: 32,973,684 A449T probably benign Het
Slc6a6 A G 6: 91,724,958 I116V probably null Het
Synj2 T A 17: 6,008,105 S58R possibly damaging Het
Tktl2 T C 8: 66,513,179 V463A probably damaging Het
Uchl5 T C 1: 143,794,344 V105A possibly damaging Het
Usp9y T C Y: 1,333,600 probably benign Het
Vmn1r200 T C 13: 22,395,497 S148P probably damaging Het
Vmn2r50 A T 7: 10,047,717 M367K possibly damaging Het
Vps13a T C 19: 16,655,206 probably benign Het
Wdr26 A T 1: 181,186,070 probably null Het
Ythdc2 T A 18: 44,850,398 M544K probably damaging Het
Other mutations in Olfr1417
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1532:Olfr1417 UTSW 19 11828619 missense probably benign 0.00
R1730:Olfr1417 UTSW 19 11828081 missense probably benign 0.06
R2032:Olfr1417 UTSW 19 11828300 missense probably damaging 1.00
R2237:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2238:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2239:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R4959:Olfr1417 UTSW 19 11828936 missense probably benign
R4973:Olfr1417 UTSW 19 11828936 missense probably benign
R5015:Olfr1417 UTSW 19 11828118 missense probably benign 0.00
R6799:Olfr1417 UTSW 19 11828814 missense possibly damaging 0.91
R6984:Olfr1417 UTSW 19 11828304 missense probably damaging 1.00
R7063:Olfr1417 UTSW 19 11828184 missense probably damaging 1.00
R7222:Olfr1417 UTSW 19 11828657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGGAGAGCAAAGCTATGTTCAC -3'
(R):5'- TGTGCAGACACCCATGTCCATGAG -3'

Sequencing Primer
(F):5'- TCCCCATGTTGAAGAATGAGTACC -3'
(R):5'- ATGTCCATGAGGCCACTCTG -3'
Posted On2013-06-12