Incidental Mutation 'R6185:Spocd1'
ID502089
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene NameSPOC domain containing 1
SynonymsOTTMUSG00000009522
MMRRC Submission 044325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6185 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129929249-129957115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129956449 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 756 (I756T)
Ref Sequence ENSEMBL: ENSMUSP00000081284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263] [ENSMUST00000128007]
Predicted Effect probably benign
Transcript: ENSMUST00000084263
AA Change: I756T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: I756T

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128007
SMART Domains Protein: ENSMUSP00000118383
Gene: ENSMUSG00000028784

DomainStartEndE-ValueType
Pfam:TFIIS_M 5 113 3.6e-28 PFAM
Blast:PAC 129 157 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147634
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,089 H894Q probably benign Het
Abca4 A T 3: 122,126,140 I1024F probably damaging Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Akr1e1 T A 13: 4,601,253 I123L probably benign Het
Angptl2 T C 2: 33,229,014 S267P probably benign Het
Ap2a1 T G 7: 44,916,170 K91T probably damaging Het
Bend7 A T 2: 4,788,522 Q379L probably damaging Het
Bicdl1 C T 5: 115,670,153 probably null Het
Cachd1 C A 4: 100,981,031 Y830* probably null Het
Ccdc158 T A 5: 92,666,854 I38F possibly damaging Het
Cep97 T A 16: 55,915,092 M448L probably benign Het
Chd9 A G 8: 91,049,137 D2572G probably damaging Het
Clcnkb C T 4: 141,414,514 V54M probably benign Het
Cln8 A G 8: 14,896,544 D186G probably benign Het
Crxos C T 7: 15,902,880 S22L possibly damaging Het
Cx3cr1 A T 9: 120,051,378 H319Q probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dmrta1 A G 4: 89,691,768 R322G probably damaging Het
Dpf1 A G 7: 29,311,271 E103G possibly damaging Het
Dsg1b T G 18: 20,399,486 V529G probably benign Het
Dst G A 1: 34,173,080 V1361I probably damaging Het
Epha4 T C 1: 77,507,106 I89V probably damaging Het
Etfdh G T 3: 79,605,807 H370N probably benign Het
Fam186a A G 15: 99,947,649 I238T unknown Het
Fbxl5 T A 5: 43,821,552 S19C probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fryl A G 5: 73,112,788 V367A probably benign Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Gm19965 A G 1: 116,821,273 E228G possibly damaging Het
Gpr89 C A 3: 96,890,833 C169F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Hsph1 A T 5: 149,617,695 C753S probably damaging Het
Igf2 T A 7: 142,658,381 S4C possibly damaging Het
Kansl3 A T 1: 36,346,018 S486T probably damaging Het
Khdrbs1 G C 4: 129,742,275 probably benign Het
Lnx1 A T 5: 74,685,608 C60* probably null Het
Lrpprc T C 17: 84,767,024 D485G probably benign Het
Ly6i A T 15: 74,980,030 S97T possibly damaging Het
Me2 G A 18: 73,791,128 Q338* probably null Het
Med16 A T 10: 79,896,363 L790Q probably damaging Het
Muc16 G T 9: 18,654,473 T2250K unknown Het
Myo10 T G 15: 25,726,510 F273C probably damaging Het
Neil3 T A 8: 53,599,147 H472L probably benign Het
Nrxn1 T A 17: 90,037,136 S57C probably damaging Het
Nup188 A T 2: 30,341,710 T1439S probably damaging Het
Olfr1128 A G 2: 87,544,743 M267T possibly damaging Het
Olfr1512 T C 14: 52,372,562 T164A possibly damaging Het
Olfr978 T C 9: 39,994,124 F105L probably benign Het
Otud7a T A 7: 63,758,385 L812Q probably damaging Het
Paip2b C T 6: 83,809,970 A95T probably benign Het
Pax4 C T 6: 28,446,348 V49I probably damaging Het
Plek C T 11: 16,981,829 A341T probably damaging Het
Prkag1 G A 15: 98,825,714 P10L probably benign Het
R3hdm1 A C 1: 128,151,861 D15A possibly damaging Het
Rad54b A T 4: 11,593,804 D144V possibly damaging Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Sbf1 A G 15: 89,305,611 L379P probably damaging Het
Sec14l3 A T 11: 4,075,244 I285F probably damaging Het
Sec31b A T 19: 44,543,284 I62N possibly damaging Het
Selp A G 1: 164,126,346 N72D probably damaging Het
Sipa1l1 T A 12: 82,425,028 S1261T probably damaging Het
Sipa1l2 A T 8: 125,468,253 Y915* probably null Het
Slc22a27 A T 19: 7,926,588 D61E probably benign Het
Slc2a7 A G 4: 150,148,993 T8A probably benign Het
Slc5a2 T C 7: 128,271,177 I529T probably damaging Het
Spg20 A C 3: 55,117,219 Q78H probably damaging Het
Stc1 G A 14: 69,038,364 C202Y probably damaging Het
Stk10 A G 11: 32,577,749 T166A probably benign Het
Syt6 A T 3: 103,585,528 D32V probably damaging Het
Tanc1 T A 2: 59,791,585 probably null Het
Tanc2 T A 11: 105,913,039 N297K probably damaging Het
Telo2 A G 17: 25,102,040 S734P probably benign Het
Tfrc T A 16: 32,618,272 Y250N probably benign Het
Tmem97 C T 11: 78,543,562 W65* probably null Het
Ubr3 T C 2: 69,938,277 M476T probably damaging Het
Ubtf T C 11: 102,314,023 T117A probably damaging Het
Usp17lb T A 7: 104,841,424 M99L probably benign Het
Uvrag A C 7: 99,140,832 probably null Het
Vmn2r63 A G 7: 42,929,011 S153P probably damaging Het
Vmn2r90 A T 17: 17,733,382 T603S probably damaging Het
Vps8 C A 16: 21,470,141 L417I probably damaging Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129953587 missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129949092 missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129947755 intron probably benign
R0005:Spocd1 UTSW 4 129956778 missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129955470 missense possibly damaging 0.56
R0939:Spocd1 UTSW 4 129948870 missense possibly damaging 0.93
R1128:Spocd1 UTSW 4 129956806 missense possibly damaging 0.57
R5747:Spocd1 UTSW 4 129954945 missense probably damaging 1.00
R5774:Spocd1 UTSW 4 129951786 missense probably benign 0.04
R5872:Spocd1 UTSW 4 129956461 missense probably damaging 0.99
R5887:Spocd1 UTSW 4 129948959 missense probably damaging 1.00
R6198:Spocd1 UTSW 4 129955415 missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129957108 unclassified probably null
R6412:Spocd1 UTSW 4 129953572 missense probably benign 0.44
R6804:Spocd1 UTSW 4 129953630 nonsense probably null
R6884:Spocd1 UTSW 4 129955404 unclassified probably benign
R6898:Spocd1 UTSW 4 129956512 unclassified probably benign
R7090:Spocd1 UTSW 4 129953898 missense
Predicted Primers PCR Primer
(F):5'- CCTCAGTGTCAGGAAGTTCTCATG -3'
(R):5'- CTCTGTGGAGCACAAACACTC -3'

Sequencing Primer
(F):5'- GTTCTCATGACCAAAACTTCAGGTC -3'
(R):5'- GAGCACAAACACTCCTTGGAG -3'
Posted On2018-02-27