Incidental Mutation 'R6189:Rsf1'
ID502384
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Nameremodeling and spacing factor 1
Synonymsp325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission 044329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6189 (G1)
Quality Score214.459
Status Not validated
Chromosome7
Chromosomal Location97579889-97692778 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGCG to GGCGACGGCTGCG at 97579906 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000178078]
Predicted Effect unknown
Transcript: ENSMUST00000042399
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,167,054 probably benign Het
Abca8a T C 11: 110,030,884 D1448G probably damaging Het
Actn2 C T 13: 12,276,440 D693N probably damaging Het
Adam3 A C 8: 24,711,336 I267R probably benign Het
Akap2 A G 4: 57,855,928 E419G probably benign Het
Aldh1l2 A G 10: 83,508,013 probably null Het
C4bp T C 1: 130,636,819 Y376C probably damaging Het
Cacna1h A G 17: 25,397,844 W101R probably damaging Het
Ccdc84 G A 9: 44,410,321 R328C probably benign Het
Ccdc97 T A 7: 25,716,098 T47S probably benign Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cntnap2 T A 6: 47,271,298 S1213T probably damaging Het
Cxcl10 A T 5: 92,348,113 L55Q probably benign Het
Cyp1a1 T C 9: 57,700,683 V198A probably damaging Het
Dclre1b A G 3: 103,803,533 V354A probably damaging Het
Dmxl1 C T 18: 49,893,335 H1837Y probably benign Het
Dnajc13 G C 9: 104,213,886 D665E probably benign Het
Dnmbp T C 19: 43,890,309 T108A probably benign Het
Dnmbp T A 19: 43,901,511 T606S probably benign Het
Dok5 T A 2: 170,800,851 I23N probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha5 A T 5: 84,237,540 F311I probably damaging Het
Erbb4 T A 1: 68,043,916 M1059L probably benign Het
Fbxo40 A G 16: 36,966,164 I681T probably benign Het
Flg2 T A 3: 93,220,074 C2098S unknown Het
Gm10471 A G 5: 26,085,693 I160T probably benign Het
Gm11397 A T 13: 33,404,444 E337D probably benign Het
Gpr87 T A 3: 59,179,229 D285V probably damaging Het
Hrh1 T A 6: 114,479,998 V80D probably damaging Het
Hunk G A 16: 90,487,881 R351K probably benign Het
Ifna12 A G 4: 88,603,011 W100R probably damaging Het
Ift57 G A 16: 49,763,813 G310S probably damaging Het
Igf1r T A 7: 68,207,336 Y1015* probably null Het
Igkv14-130 T C 6: 67,791,448 I96T probably damaging Het
Il34 C T 8: 110,742,718 S155N probably benign Het
Itga7 T C 10: 128,950,403 S938P possibly damaging Het
Itgam A G 7: 128,112,504 M764V probably benign Het
Lao1 T A 4: 118,967,880 M299K probably benign Het
Lnpep A T 17: 17,566,739 S533T possibly damaging Het
Lrp4 T C 2: 91,475,234 V283A possibly damaging Het
Magi3 G T 3: 104,050,865 H635N probably damaging Het
Mecr A T 4: 131,865,254 probably null Het
Mgrn1 T C 16: 4,910,810 probably null Het
Micalcl A C 7: 112,412,880 N646H probably damaging Het
Mymk C T 2: 27,067,365 V39I possibly damaging Het
Nav3 T C 10: 109,720,019 S1684G probably damaging Het
Ntn5 A T 7: 45,693,220 D330V probably benign Het
Nupl2 G T 5: 24,175,454 G149V probably damaging Het
Nutm2 T A 13: 50,469,738 V157D possibly damaging Het
Obscn T C 11: 59,069,934 I3460V probably benign Het
Olfr1037 A T 2: 86,084,913 M288K possibly damaging Het
Pcdh15 C T 10: 74,342,651 A580V probably null Het
Pcdhb10 T A 18: 37,412,403 H177Q probably damaging Het
Pitx2 T C 3: 129,218,469 Y130H probably damaging Het
Pmch G T 10: 88,091,386 probably null Het
Pofut2 T A 10: 77,268,586 I399N probably damaging Het
Prr36 C A 8: 4,214,177 probably benign Het
Ptprq C A 10: 107,517,887 C2256F probably damaging Het
Rassf5 G A 1: 131,244,979 A51V probably damaging Het
Retnla A G 16: 48,842,895 I54V probably benign Het
Rimbp2 A G 5: 128,803,897 L142P probably benign Het
Ripk1 A G 13: 34,032,501 T564A probably benign Het
Robo4 G A 9: 37,403,533 E228K probably benign Het
Rusc1 A T 3: 89,089,012 L132Q probably damaging Het
Setd1a T C 7: 127,778,283 probably null Het
Slc38a6 A T 12: 73,310,196 K122M probably damaging Het
Susd5 A T 9: 114,095,658 D203V probably damaging Het
Trip4 G A 9: 65,879,152 R110* probably null Het
Tuba4a T A 1: 75,216,874 I95F probably benign Het
Ube2q2 T A 9: 55,162,983 S70T probably benign Het
Umodl1 A G 17: 30,996,282 I1027V possibly damaging Het
Unc80 G A 1: 66,677,471 V2917I probably benign Het
Vmn1r70 T A 7: 10,633,671 C29S probably benign Het
Vmn2r94 A T 17: 18,257,734 D138E probably benign Het
Wee2 C T 6: 40,449,683 H129Y probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp872 A T 9: 22,197,131 D42V probably benign Het
Zic5 T G 14: 122,464,974 D115A unknown Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
R7352:Rsf1 UTSW 7 97579926 unclassified probably benign
R7380:Rsf1 UTSW 7 97579915 unclassified probably benign
R7393:Rsf1 UTSW 7 97579917 unclassified probably benign
R7395:Rsf1 UTSW 7 97579926 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTTGAAGTCGTAGAGGG -3'
(R):5'- CAGGGTATCTATGGAGAGCTAAAGC -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On2018-02-27