Incidental Mutation 'R5587:Rsf1'
ID438818
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Nameremodeling and spacing factor 1
Synonymsp325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97579889-97692778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97662121 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 686 (L686P)
Ref Sequence ENSEMBL: ENSMUSP00000102771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107153] [ENSMUST00000123731]
Predicted Effect probably benign
Transcript: ENSMUST00000042399
AA Change: L686P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623
AA Change: L686P

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107153
AA Change: L686P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623
AA Change: L686P

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206866
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGTTGTAAGGGGTGCTC -3'
(R):5'- GGGGCAATCTGGCTTCTTCTTC -3'

Sequencing Primer
(F):5'- CCTTGTGAAGTGGCTGAAACTCC -3'
(R):5'- CCGACTTGATATCCTAATTGTCAAC -3'
Posted On2016-10-26