Mutagenetix > Incidental Mutation

Incidental Mutation 'R6213:Muc2'

503561

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044346-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R6213 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141305151 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 152 (C152R)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026590
AA Change: C152R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: C152R

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: C591R

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	G	16: 20,218,762 (GRCm39)	Y207H	probably damaging	Het
Adcy7	G	A	8: 89,040,765 (GRCm39)	V335M	probably damaging	Het
Apol11b	A	C	15: 77,522,200 (GRCm39)	D32E	possibly damaging	Het
Ccdc13	A	G	9: 121,627,975 (GRCm39)		probably benign	Het
Cdkn1b	T	A	6: 134,898,206 (GRCm39)	D108E	probably benign	Het
Cep290	A	G	10: 100,359,222 (GRCm39)	D984G	probably benign	Het
Csde1	T	C	3: 102,947,830 (GRCm39)	V128A	probably damaging	Het
Csmd3	A	G	15: 47,492,656 (GRCm39)	S3162P	probably damaging	Het
D5Ertd579e	G	A	5: 36,759,978 (GRCm39)	T1394I	probably damaging	Het
Ddx6	T	A	9: 44,539,990 (GRCm39)	L306Q	probably damaging	Het
Dmxl1	T	A	18: 49,996,082 (GRCm39)	S403T	possibly damaging	Het
F11	G	T	8: 45,694,537 (GRCm39)	T608K	probably damaging	Het
Flrt3	C	T	2: 140,503,085 (GRCm39)	R181H	probably damaging	Het
Hs3st1	A	T	5: 39,771,864 (GRCm39)	C260S	probably damaging	Het
Ighv7-1	A	T	12: 113,860,141 (GRCm39)	S84T	probably damaging	Het
Inpp4b	A	G	8: 82,724,019 (GRCm39)	D332G	probably damaging	Het
Irf2bpl	T	C	12: 86,930,367 (GRCm39)	Q102R	probably benign	Het
Itpr3	T	A	17: 27,330,174 (GRCm39)	D1597E	probably benign	Het
Kcnd1	G	C	X: 7,690,148 (GRCm39)	A23P	probably damaging	Homo
Lypd8	A	G	11: 58,281,160 (GRCm39)	T241A	probably benign	Het
Map1lc3a	T	C	2: 155,118,935 (GRCm39)		probably null	Het
Mast1	G	A	8: 85,642,198 (GRCm39)	T1052I	probably damaging	Het
Muc5b	A	T	7: 141,415,903 (GRCm39)	M2950L	probably benign	Het
Muc5b	A	G	7: 141,421,356 (GRCm39)	D4282G	possibly damaging	Het
Myo16	G	T	8: 10,420,963 (GRCm39)		probably null	Het
Myo9a	T	A	9: 59,734,541 (GRCm39)	F708I	probably damaging	Het
Nadsyn1	A	T	7: 143,353,549 (GRCm39)	F558Y	probably benign	Het
Nat9	A	T	11: 115,075,932 (GRCm39)	W30R	probably damaging	Het
Nipbl	A	G	15: 8,364,390 (GRCm39)	L1338S	probably damaging	Het
Nipsnap3b	A	G	4: 53,017,066 (GRCm39)	T97A	probably benign	Het
Npepps	A	T	11: 97,132,823 (GRCm39)	Y301*	probably null	Het
Nrcam	C	T	12: 44,609,215 (GRCm39)	P447S	possibly damaging	Het
Or14c41	A	G	7: 86,234,485 (GRCm39)	M1V	probably null	Het
Or1o4	T	C	17: 37,591,264 (GRCm39)	S16G	probably benign	Het
Or2a14	A	G	6: 43,130,821 (GRCm39)	N194S	possibly damaging	Het
Or52b4	T	C	7: 102,184,139 (GRCm39)	Y62H	probably damaging	Het
Pacsin3	G	T	2: 91,090,779 (GRCm39)	V29F	probably damaging	Het
Pdzrn3	A	C	6: 101,354,805 (GRCm39)	D15E	probably damaging	Het
Phf20l1	T	C	15: 66,504,752 (GRCm39)		probably null	Het
Pign	A	C	1: 105,516,991 (GRCm39)	V545G	possibly damaging	Het
Pkhd1	T	C	1: 20,593,994 (GRCm39)	N1373S	possibly damaging	Het
Ptchd4	T	A	17: 42,688,251 (GRCm39)	H264Q	probably benign	Het
Ptpn3	G	T	4: 57,265,012 (GRCm39)	Q73K	probably damaging	Het
Ptrh1	G	A	2: 32,666,757 (GRCm39)	V109I	probably benign	Het
Reg1	A	T	6: 78,404,386 (GRCm39)	I87F	possibly damaging	Het
Rrp12	C	A	19: 41,857,217 (GRCm39)	V1186L	probably benign	Het
Sall1	AGTGGTGGTGGTGGTGGTGGTGG	AGTGGTGGTGGTGGTGGTGG	8: 89,759,686 (GRCm39)		probably benign	Het
Slc23a3	A	C	1: 75,108,392 (GRCm39)	F279V	probably benign	Het
Smtnl2	G	A	11: 72,292,225 (GRCm39)	A274V	probably damaging	Het
Suds3	A	G	5: 117,244,727 (GRCm39)	L115P	probably damaging	Het
Tekt2	G	A	4: 126,216,989 (GRCm39)	A260V	probably damaging	Het
Tgfb3	T	A	12: 86,104,621 (GRCm39)	Y391F	probably damaging	Het
Topbp1	T	C	9: 103,209,950 (GRCm39)	S866P	probably benign	Het
Tspan14	A	G	14: 40,635,372 (GRCm39)	Y175H	probably benign	Het
Vars2	T	C	17: 35,971,332 (GRCm39)	T568A	probably benign	Het
Vmn1r216	T	G	13: 23,283,339 (GRCm39)	D7E	probably benign	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,578,962 (GRCm39)		probably benign	Het
Zfp281	T	C	1: 136,553,250 (GRCm39)	V76A	probably benign	Het
Zfp36l2	T	C	17: 84,493,980 (GRCm39)	N219S	probably damaging	Het
Zfp626	T	C	7: 27,507,717 (GRCm39)	M42T	probably benign	Het
Zscan21	C	T	5: 138,123,359 (GRCm39)	P13S	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- CCCTTGAATGAACAGTTGCTG -3'
(R):5'- AGTGGGCATGTTTGACTCAC -3'

Sequencing Primer
(F):5'- GAACAGTTGCTGGTCTGTCCC -3'
(R):5'- GGCATGTTTGACTCACTAGGAAC -3'

Posted On

2018-02-27