Incidental Mutation 'R6220:Nkx6-3'
ID503950
Institutional Source Beutler Lab
Gene Symbol Nkx6-3
Ensembl Gene ENSMUSG00000063672
Gene NameNK6 homeobox 3
Synonyms9130417I07Rik, Nkx6.3
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location23153269-23158948 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 23153971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071588] [ENSMUST00000084038] [ENSMUST00000110688] [ENSMUST00000117296] [ENSMUST00000118733] [ENSMUST00000121075] [ENSMUST00000121802] [ENSMUST00000123418] [ENSMUST00000141784] [ENSMUST00000173248] [ENSMUST00000173573]
Predicted Effect probably null
Transcript: ENSMUST00000071588
SMART Domains Protein: ENSMUSP00000071517
Gene: ENSMUSG00000063672

DomainStartEndE-ValueType
HOX 140 202 3.88e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084038
SMART Domains Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110688
SMART Domains Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 944 1048 1.9e-60 SMART
low complexity region 1071 1080 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
DEATH 1426 1520 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117296
SMART Domains Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118733
SMART Domains Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121075
SMART Domains Protein: ENSMUSP00000112966
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121802
SMART Domains Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123418
SMART Domains Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141784
SMART Domains Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141930
Predicted Effect probably benign
Transcript: ENSMUST00000173248
SMART Domains Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173573
SMART Domains Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a significantly decreased number of gastrin-producing (G) cells in the stomach antrum, hypogastrinemia, and increased stomach luminal pH, with a corresponding increase in antral somatostatin-producing (D) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Nkx6-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0138:Nkx6-3 UTSW 8 23153591 missense probably benign 0.00
R0360:Nkx6-3 UTSW 8 23157706 missense possibly damaging 0.93
R0364:Nkx6-3 UTSW 8 23157706 missense possibly damaging 0.93
R3954:Nkx6-3 UTSW 8 23153726 missense possibly damaging 0.53
R4724:Nkx6-3 UTSW 8 23156269 missense probably damaging 1.00
R4885:Nkx6-3 UTSW 8 23153898 missense possibly damaging 0.95
R4969:Nkx6-3 UTSW 8 23157709 missense probably damaging 1.00
R5165:Nkx6-3 UTSW 8 23153743 missense probably damaging 1.00
R6262:Nkx6-3 UTSW 8 23153847 missense probably benign 0.34
R6894:Nkx6-3 UTSW 8 23157616 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACTGACATCCTGAGCAGACC -3'
(R):5'- CCTGTGCTAGGTAGAAGTAGGG -3'

Sequencing Primer
(F):5'- ACATCCTGAGCAGACCGGTTG -3'
(R):5'- TGTGCTAGGTAGAAGTAGGGAGGAG -3'
Posted On2018-02-27