Incidental Mutation 'R6246:Cdhr2'
ID505801
Institutional Source Beutler Lab
Gene Symbol Cdhr2
Ensembl Gene ENSMUSG00000034918
Gene Namecadherin-related family member 2
SynonymsLOC268663, Pcdh24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6246 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54701461-54736662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54719710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 451 (V451A)
Ref Sequence ENSEMBL: ENSMUSP00000043596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145]
Predicted Effect probably damaging
Transcript: ENSMUST00000037145
AA Change: V451A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918
AA Change: V451A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Cdhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cdhr2 APN 13 54718299 missense probably damaging 1.00
IGL00596:Cdhr2 APN 13 54720997 missense probably damaging 0.97
IGL00840:Cdhr2 APN 13 54720152 missense probably damaging 0.96
IGL00956:Cdhr2 APN 13 54718343 missense probably damaging 1.00
IGL01101:Cdhr2 APN 13 54718135 splice site probably benign
IGL01150:Cdhr2 APN 13 54731118 missense probably benign
IGL01412:Cdhr2 APN 13 54725894 missense probably damaging 1.00
IGL01515:Cdhr2 APN 13 54718238 missense probably benign 0.17
IGL02005:Cdhr2 APN 13 54719763 missense probably benign 0.00
IGL02187:Cdhr2 APN 13 54733710 missense possibly damaging 0.86
IGL02312:Cdhr2 APN 13 54717888 missense probably null 0.97
IGL02877:Cdhr2 APN 13 54734737 missense probably benign 0.39
IGL03072:Cdhr2 APN 13 54726661 missense probably benign 0.00
IGL03263:Cdhr2 APN 13 54718113 missense possibly damaging 0.75
FR4449:Cdhr2 UTSW 13 54725924 small insertion probably benign
PIT4494001:Cdhr2 UTSW 13 54718442 critical splice acceptor site probably null
PIT4498001:Cdhr2 UTSW 13 54718239 missense possibly damaging 0.75
R0041:Cdhr2 UTSW 13 54726838 missense probably damaging 1.00
R0149:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0329:Cdhr2 UTSW 13 54734801 unclassified probably benign
R0361:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0365:Cdhr2 UTSW 13 54718292 missense probably benign 0.00
R0598:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R0774:Cdhr2 UTSW 13 54717855 missense probably damaging 1.00
R1330:Cdhr2 UTSW 13 54734268 missense possibly damaging 0.67
R1458:Cdhr2 UTSW 13 54717872 missense probably damaging 0.99
R1659:Cdhr2 UTSW 13 54719761 missense probably damaging 1.00
R1698:Cdhr2 UTSW 13 54719581 missense probably benign 0.00
R2061:Cdhr2 UTSW 13 54720818 missense probably damaging 1.00
R2098:Cdhr2 UTSW 13 54715644 missense probably benign 0.15
R2135:Cdhr2 UTSW 13 54720947 missense probably damaging 1.00
R2365:Cdhr2 UTSW 13 54718088 missense probably benign 0.01
R3693:Cdhr2 UTSW 13 54726416 missense probably damaging 1.00
R3968:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R3970:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R4001:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4003:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4030:Cdhr2 UTSW 13 54717861 missense probably damaging 1.00
R4088:Cdhr2 UTSW 13 54717888 missense probably null 0.97
R4256:Cdhr2 UTSW 13 54714005 missense probably damaging 0.99
R4322:Cdhr2 UTSW 13 54733721 missense probably benign 0.00
R4396:Cdhr2 UTSW 13 54715665 missense probably damaging 0.99
R4591:Cdhr2 UTSW 13 54715684 missense probably benign 0.18
R4726:Cdhr2 UTSW 13 54718539 missense probably damaging 0.99
R5370:Cdhr2 UTSW 13 54720887 missense probably damaging 1.00
R5396:Cdhr2 UTSW 13 54736456 missense probably benign
R5447:Cdhr2 UTSW 13 54733250 missense probably damaging 1.00
R5654:Cdhr2 UTSW 13 54736536 missense probably benign
R5727:Cdhr2 UTSW 13 54724308 missense possibly damaging 0.95
R5771:Cdhr2 UTSW 13 54726695 missense probably damaging 0.99
R5924:Cdhr2 UTSW 13 54726683 missense probably benign 0.01
R5928:Cdhr2 UTSW 13 54734019 missense probably benign 0.01
R6351:Cdhr2 UTSW 13 54726776 missense probably benign 0.16
R6358:Cdhr2 UTSW 13 54736546 missense probably damaging 0.99
R6433:Cdhr2 UTSW 13 54718512 missense probably damaging 0.97
R7044:Cdhr2 UTSW 13 54733321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGACAATGGTACCTTCCTG -3'
(R):5'- ATCACTCACCTGGATTTTGTCAG -3'

Sequencing Primer
(F):5'- CCAGGATGCTGAAGCCTTCAATG -3'
(R):5'- TCAGTGACCAGATAACCTGTTGGAC -3'
Posted On2018-02-28