Incidental Mutation 'R6467:Chd1l'
ID516625
Institutional Source Beutler Lab
Gene Symbol Chd1l
Ensembl Gene ENSMUSG00000028089
Gene Namechromodomain helicase DNA binding protein 1-like
Synonyms4432404A22Rik, Snf2p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97560742-97610203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97563533 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 815 (N815K)
Ref Sequence ENSEMBL: ENSMUSP00000029730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029730]
Predicted Effect probably damaging
Transcript: ENSMUST00000029730
AA Change: N815K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029730
Gene: ENSMUSG00000028089
AA Change: N815K

DomainStartEndE-ValueType
DEXDc 36 224 1.83e-38 SMART
HELICc 371 453 7.45e-21 SMART
low complexity region 548 570 N/A INTRINSIC
coiled coil region 643 680 N/A INTRINSIC
low complexity region 692 709 N/A INTRINSIC
PDB:2FG1|A 718 878 6e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195962
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Chd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Chd1l APN 3 97590605 missense probably damaging 1.00
IGL01349:Chd1l APN 3 97591234 missense probably benign 0.07
IGL02115:Chd1l APN 3 97589904 critical splice donor site probably null
IGL02418:Chd1l APN 3 97581099 missense probably benign 0.39
IGL02717:Chd1l APN 3 97583907 missense probably damaging 1.00
IGL03091:Chd1l APN 3 97563547 missense probably damaging 1.00
IGL03048:Chd1l UTSW 3 97597763 missense probably benign 0.01
R0125:Chd1l UTSW 3 97587149 missense probably benign 0.00
R0702:Chd1l UTSW 3 97566794 missense probably benign 0.05
R1226:Chd1l UTSW 3 97562625 nonsense probably null
R1237:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1238:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1239:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1301:Chd1l UTSW 3 97603648 splice site probably benign
R1366:Chd1l UTSW 3 97581149 missense probably damaging 0.99
R1444:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1445:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1500:Chd1l UTSW 3 97582805 missense probably benign 0.01
R1619:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1640:Chd1l UTSW 3 97580991 missense probably benign 0.00
R1762:Chd1l UTSW 3 97588299 missense probably damaging 1.00
R2291:Chd1l UTSW 3 97591283 missense probably damaging 1.00
R2444:Chd1l UTSW 3 97590566 missense probably damaging 1.00
R4008:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4011:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4106:Chd1l UTSW 3 97597703 missense probably benign 0.09
R4857:Chd1l UTSW 3 97572659 missense probably benign 0.27
R5008:Chd1l UTSW 3 97583908 missense probably damaging 1.00
R5337:Chd1l UTSW 3 97562616 missense probably damaging 1.00
R5844:Chd1l UTSW 3 97572567 missense probably benign 0.04
R6283:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6298:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6309:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6311:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6321:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6327:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6364:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6366:Chd1l UTSW 3 97594160 missense probably benign 0.00
R6483:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6493:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6494:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6585:Chd1l UTSW 3 97597772 missense probably damaging 0.96
R6925:Chd1l UTSW 3 97582826 missense probably damaging 1.00
R7148:Chd1l UTSW 3 97591316 missense probably damaging 1.00
R7244:Chd1l UTSW 3 97597750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTACCAAGCACATCAAGGGG -3'
(R):5'- TACCATGACATAAGACGGGCAG -3'

Sequencing Primer
(F):5'- CAAGGGGAGTCTTGACATTTCG -3'
(R):5'- CATGCCATACATTGTAGGATACTGC -3'
Posted On2018-05-21