Incidental Mutation 'R6467:Sec14l2'
ID516659
Institutional Source Beutler Lab
Gene Symbol Sec14l2
Ensembl Gene ENSMUSG00000003585
Gene NameSEC14-like lipid binding 2
SynonymsSpf, tap, 1300013M05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_144520.2; MGI:1915065

Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4097039-4123415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4111161 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 100 (Y100C)
Ref Sequence ENSEMBL: ENSMUSP00000003681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003681]
Predicted Effect probably damaging
Transcript: ENSMUST00000003681
AA Change: Y100C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003681
Gene: ENSMUSG00000003585
AA Change: Y100C

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.16e-6 SMART
SEC14 76 246 8.31e-62 SMART
Blast:SEC14 257 338 2e-42 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145173
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype Strain: 3771069
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased cholesterol synthesis and plasma levels under fasting conditions compared to wild-type mice. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Sec14l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Sec14l2 APN 11 4098317 missense probably benign
IGL01369:Sec14l2 APN 11 4103432 missense probably benign 0.03
IGL01404:Sec14l2 APN 11 4116710 missense possibly damaging 0.71
IGL01622:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL01623:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL02007:Sec14l2 APN 11 4111114 missense probably benign 0.00
IGL02632:Sec14l2 APN 11 4111222 missense probably benign 0.00
IGL02644:Sec14l2 APN 11 4103380 splice site probably benign
Samoas UTSW 11 4103980 missense possibly damaging 0.74
P0027:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
PIT1430001:Sec14l2 UTSW 11 4109209 nonsense probably null
R0113:Sec14l2 UTSW 11 4103661 splice site probably benign
R1705:Sec14l2 UTSW 11 4103980 missense possibly damaging 0.74
R2044:Sec14l2 UTSW 11 4111435 splice site probably benign
R2180:Sec14l2 UTSW 11 4108964 missense probably damaging 1.00
R2215:Sec14l2 UTSW 11 4109169 missense probably damaging 1.00
R5301:Sec14l2 UTSW 11 4118727 start gained probably benign
R5668:Sec14l2 UTSW 11 4109189 missense probably damaging 1.00
R5949:Sec14l2 UTSW 11 4108972 missense probably damaging 1.00
R6050:Sec14l2 UTSW 11 4111477 missense probably benign 0.36
R6369:Sec14l2 UTSW 11 4103962 missense possibly damaging 0.69
R6798:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7142:Sec14l2 UTSW 11 4098379 missense probably benign 0.04
R7385:Sec14l2 UTSW 11 4116750 nonsense probably null
T0722:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
X0067:Sec14l2 UTSW 11 4116737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCCACCCATATGTGAC -3'
(R):5'- GTTGCAAAATAGGTATCTTCGGGC -3'

Sequencing Primer
(F):5'- ACCCATATGTGACATCCTGC -3'
(R):5'- CACCCAAGGGAGAGAGGTG -3'
Posted On2018-05-21