Mutagenetix > Incidental Mutation

Incidental Mutation 'R6462:Nup98'

517639

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

044596-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6462 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101768607-101859359 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101844223 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 37 (F37L)

Ref Sequence

ENSEMBL: ENSMUSP00000147445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000070165
AA Change: F37L

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: F37L

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209242

Predicted Effect

unknown
Transcript: ENSMUST00000210682
AA Change: F37L

Predicted Effect

probably benign
Transcript: ENSMUST00000211005
AA Change: F37L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

unknown
Transcript: ENSMUST00000211022
AA Change: F37L

Predicted Effect

unknown
Transcript: ENSMUST00000211235
AA Change: F37L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211375

Meta Mutation Damage Score

0.1137

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.6%

Validation Efficiency

95% (37/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arpc1a	C	T	5: 145,045,197 (GRCm39)	S362F	probably benign	Het
Brd9	C	T	13: 74,088,788 (GRCm39)	A171V	probably damaging	Het
Camta1	A	G	4: 151,170,621 (GRCm39)	V62A	probably damaging	Het
Cdc5l	G	A	17: 45,703,975 (GRCm39)	R750C	probably benign	Het
Ctdp1	C	T	18: 80,463,689 (GRCm39)	E116K	probably damaging	Het
Dync2i1	T	C	12: 116,193,251 (GRCm39)	N567S	probably benign	Het
Enpp5	G	A	17: 44,396,155 (GRCm39)	G356S	probably damaging	Het
Epor	T	C	9: 21,870,551 (GRCm39)	E443G	probably benign	Het
Fam90a1a	A	T	8: 22,449,298 (GRCm39)	Q14L	probably benign	Het
Herc4	T	C	10: 63,124,880 (GRCm39)	L498P	probably benign	Het
Kif1b	T	C	4: 149,277,053 (GRCm39)	M1337V	probably benign	Het
Lmod2	T	G	6: 24,604,300 (GRCm39)	V425G	probably benign	Het
Ly6c1	T	A	15: 74,916,178 (GRCm39)		probably benign	Het
Me2	C	A	18: 73,908,470 (GRCm39)	V490F	probably benign	Het
Mllt3	T	C	4: 87,692,338 (GRCm39)	T27A	probably damaging	Het
Mmp1a	T	C	9: 7,467,039 (GRCm39)	Y239H	probably benign	Het
Mycbp2	A	G	14: 103,373,993 (GRCm39)		probably null	Het
Myo15b	A	C	11: 115,750,268 (GRCm39)	E346A	probably benign	Het
Myo3a	T	C	2: 22,448,423 (GRCm39)	F66S	probably damaging	Het
Ncor2	T	C	5: 125,101,236 (GRCm39)	Y137C	probably damaging	Het
Odf2l	T	G	3: 144,852,672 (GRCm39)	L472R	probably damaging	Het
Or10al2	T	C	17: 37,983,111 (GRCm39)	Y66H	probably damaging	Het
P4ha3	T	A	7: 99,963,873 (GRCm39)	I463N	probably damaging	Het
Pappa	C	A	4: 65,043,128 (GRCm39)	T117K	probably damaging	Het
Ppme1	C	A	7: 99,987,599 (GRCm39)	R271M	probably benign	Het
Rps6ka4	T	G	19: 6,814,957 (GRCm39)	E249A	possibly damaging	Het
Rxfp1	T	A	3: 79,555,596 (GRCm39)	I587F	probably benign	Het
Sipa1l2	A	G	8: 126,217,969 (GRCm39)	V456A	probably damaging	Het
Slc25a23	T	A	17: 57,359,720 (GRCm39)	I344F	probably damaging	Het
St3gal1	A	G	15: 66,983,195 (GRCm39)	V187A	possibly damaging	Het
Tbc1d10c	T	C	19: 4,234,893 (GRCm39)	I389M	possibly damaging	Het
Tep1	A	G	14: 51,081,836 (GRCm39)	F1205L	probably benign	Het
Tgfbr1	T	A	4: 47,402,846 (GRCm39)	H214Q	probably damaging	Het
Traf3ip2	T	A	10: 39,515,243 (GRCm39)	N340K	probably benign	Het
Zbbx	T	C	3: 74,985,966 (GRCm39)	E362G	probably benign	Het
Zfp46	A	C	4: 136,017,924 (GRCm39)	T253P	probably damaging	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	101,844,194 (GRCm39)	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	101,803,178 (GRCm39)	missense	probably benign
IGL00798:Nup98	APN	7	101,796,411 (GRCm39)	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	101,835,125 (GRCm39)	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	101,843,918 (GRCm39)	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	101,832,693 (GRCm39)	missense	probably benign	0.37
IGL02490:Nup98	APN	7	101,801,573 (GRCm39)	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	101,832,752 (GRCm39)	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	101,784,171 (GRCm39)	missense	probably benign	0.00
R0040:Nup98	UTSW	7	101,841,241 (GRCm39)	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	101,788,859 (GRCm39)	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	101,801,635 (GRCm39)	missense	probably null
R0471:Nup98	UTSW	7	101,788,004 (GRCm39)	missense	probably benign	0.13
R0538:Nup98	UTSW	7	101,835,892 (GRCm39)	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	101,801,660 (GRCm39)	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	101,784,087 (GRCm39)	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.03
R1889:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	101,829,631 (GRCm39)	missense	probably damaging	0.96
R3423:Nup98	UTSW	7	101,834,084 (GRCm39)	missense	probably benign	0.03
R4361:Nup98	UTSW	7	101,794,921 (GRCm39)	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	101,834,038 (GRCm39)	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	101,802,403 (GRCm39)	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	101,845,007 (GRCm39)	missense	unknown
R4924:Nup98	UTSW	7	101,784,185 (GRCm39)	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5069:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5233:Nup98	UTSW	7	101,845,029 (GRCm39)	missense	unknown
R5779:Nup98	UTSW	7	101,801,568 (GRCm39)	missense	probably benign
R5922:Nup98	UTSW	7	101,803,224 (GRCm39)	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	101,829,636 (GRCm39)	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6343:Nup98	UTSW	7	101,843,957 (GRCm39)	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	101,825,522 (GRCm39)	missense	probably damaging	1.00
R6577:Nup98	UTSW	7	101,778,053 (GRCm39)	splice site	probably null
R6900:Nup98	UTSW	7	101,835,169 (GRCm39)	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	101,844,248 (GRCm39)	missense	unknown
R7218:Nup98	UTSW	7	101,841,107 (GRCm39)	splice site	probably null
R7235:Nup98	UTSW	7	101,774,491 (GRCm39)	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R7402:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.00
R7427:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7428:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7584:Nup98	UTSW	7	101,825,596 (GRCm39)	missense	probably benign	0.02
R7646:Nup98	UTSW	7	101,803,242 (GRCm39)	missense	probably benign	0.01
R7648:Nup98	UTSW	7	101,773,404 (GRCm39)	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	101,802,464 (GRCm39)	splice site	probably null
R7827:Nup98	UTSW	7	101,773,569 (GRCm39)	missense	probably benign	0.10
R7884:Nup98	UTSW	7	101,825,556 (GRCm39)	missense	probably benign	0.12
R7943:Nup98	UTSW	7	101,844,029 (GRCm39)	missense	probably benign	0.10
R8034:Nup98	UTSW	7	101,794,930 (GRCm39)	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	101,835,859 (GRCm39)	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	101,783,895 (GRCm39)	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	101,844,173 (GRCm39)	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9148:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9223:Nup98	UTSW	7	101,834,167 (GRCm39)	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9249:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9272:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9274:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9283:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9326:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9466:Nup98	UTSW	7	101,818,611 (GRCm39)	missense	probably benign	0.05
R9492:Nup98	UTSW	7	101,778,252 (GRCm39)	missense	probably benign	0.11
R9661:Nup98	UTSW	7	101,782,019 (GRCm39)	nonsense	probably null
T0970:Nup98	UTSW	7	101,835,959 (GRCm39)	unclassified	probably benign
X0054:Nup98	UTSW	7	101,796,415 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAACCCAGTGCTTGTGGAG -3'
(R):5'- CCATGGAAATTGGAGAAAGGTTTC -3'

Sequencing Primer
(F):5'- CTGGCTGGCTAAATGAACTGGTAC -3'
(R):5'- TCAAATTGCATTAGTGGTTCTGC -3'

Posted On

2018-05-21