Mutagenetix > Incidental Mutation

Incidental Mutation 'R6900:Nup98'

538489

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

044994-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6900 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101768607-101859359 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101835169 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 228 (F228S)

Ref Sequence

ENSEMBL: ENSMUSP00000147454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000070165
AA Change: F228S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: F228S

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000210682
AA Change: F228S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211005
AA Change: F228S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211022
AA Change: F228S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211235
AA Change: F228S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000211764

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	T	C	8: 78,037,491 (GRCm39)	D579G	probably damaging	Het
Cc2d2b	A	G	19: 40,813,518 (GRCm39)	S1333G	probably null	Het
Cep250	A	G	2: 155,838,190 (GRCm39)		probably null	Het
Chd3	T	C	11: 69,245,271 (GRCm39)	D1149G	possibly damaging	Het
Dnah7a	A	G	1: 53,701,510 (GRCm39)	L215P	probably damaging	Het
Fbn2	T	C	18: 58,209,903 (GRCm39)	M993V	probably benign	Het
Ggt5	A	T	10: 75,446,371 (GRCm39)	Q523L	possibly damaging	Het
Hcn1	A	G	13: 117,793,363 (GRCm39)	N205S	probably benign	Het
Htr1b	A	T	9: 81,513,623 (GRCm39)	I328N	probably damaging	Het
Itgav	T	A	2: 83,633,591 (GRCm39)	F980Y	probably damaging	Het
Kbtbd2	A	G	6: 56,757,008 (GRCm39)	S243P	probably damaging	Het
Kcnd2	A	G	6: 21,216,587 (GRCm39)	N97S	probably damaging	Het
Kifbp	T	C	10: 62,394,908 (GRCm39)	Y578C	probably damaging	Het
Lars1	T	C	18: 42,367,675 (GRCm39)	K468E	probably benign	Het
Map3k1	T	C	13: 111,890,350 (GRCm39)	N1283S	probably benign	Het
Mapk8ip3	A	T	17: 25,128,097 (GRCm39)		probably null	Het
Mroh2b	A	G	15: 4,938,469 (GRCm39)	I253V	probably benign	Het
Or4k1	A	T	14: 50,377,295 (GRCm39)	V267E	possibly damaging	Het
Pdzd2	A	G	15: 12,374,123 (GRCm39)	F2004S	probably benign	Het
Pkhd1	A	T	1: 20,604,925 (GRCm39)	L1130Q	probably benign	Het
Pparg	G	T	6: 115,449,949 (GRCm39)	R286L	possibly damaging	Het
Ppp1r16a	A	G	15: 76,575,923 (GRCm39)	S96G	probably damaging	Het
Psg29	C	T	7: 16,938,857 (GRCm39)	Q44*	probably null	Het
Rgs22	A	G	15: 36,010,893 (GRCm39)	F1227S	possibly damaging	Het
Saxo1	T	C	4: 86,363,571 (GRCm39)	D304G	possibly damaging	Het
Sec14l1	T	C	11: 117,008,049 (GRCm39)	Y12H	probably damaging	Het
Sh3bp4	A	G	1: 89,073,489 (GRCm39)	N779S	probably benign	Het
Sin3a	T	C	9: 57,014,858 (GRCm39)	V693A	probably damaging	Het
Teddm1b	G	A	1: 153,750,956 (GRCm39)	C255Y	probably benign	Het
Ttk	T	A	9: 83,754,083 (GRCm39)	S819T	probably damaging	Het
Zfp362	C	T	4: 128,679,808 (GRCm39)	C273Y	probably damaging	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	101,844,194 (GRCm39)	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	101,803,178 (GRCm39)	missense	probably benign
IGL00798:Nup98	APN	7	101,796,411 (GRCm39)	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	101,835,125 (GRCm39)	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	101,843,918 (GRCm39)	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	101,832,693 (GRCm39)	missense	probably benign	0.37
IGL02490:Nup98	APN	7	101,801,573 (GRCm39)	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	101,832,752 (GRCm39)	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	101,784,171 (GRCm39)	missense	probably benign	0.00
R0040:Nup98	UTSW	7	101,841,241 (GRCm39)	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	101,788,859 (GRCm39)	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	101,801,635 (GRCm39)	missense	probably null
R0471:Nup98	UTSW	7	101,788,004 (GRCm39)	missense	probably benign	0.13
R0538:Nup98	UTSW	7	101,835,892 (GRCm39)	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	101,801,660 (GRCm39)	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	101,784,087 (GRCm39)	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.03
R1889:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	101,829,631 (GRCm39)	missense	probably damaging	0.96
R3423:Nup98	UTSW	7	101,834,084 (GRCm39)	missense	probably benign	0.03
R4361:Nup98	UTSW	7	101,794,921 (GRCm39)	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	101,834,038 (GRCm39)	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	101,802,403 (GRCm39)	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	101,845,007 (GRCm39)	missense	unknown
R4924:Nup98	UTSW	7	101,784,185 (GRCm39)	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5069:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5233:Nup98	UTSW	7	101,845,029 (GRCm39)	missense	unknown
R5779:Nup98	UTSW	7	101,801,568 (GRCm39)	missense	probably benign
R5922:Nup98	UTSW	7	101,803,224 (GRCm39)	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	101,829,636 (GRCm39)	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6343:Nup98	UTSW	7	101,843,957 (GRCm39)	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	101,825,522 (GRCm39)	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	101,844,223 (GRCm39)	missense	probably benign	0.03
R6577:Nup98	UTSW	7	101,778,053 (GRCm39)	splice site	probably null
R7205:Nup98	UTSW	7	101,844,248 (GRCm39)	missense	unknown
R7218:Nup98	UTSW	7	101,841,107 (GRCm39)	splice site	probably null
R7235:Nup98	UTSW	7	101,774,491 (GRCm39)	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R7402:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.00
R7427:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7428:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7584:Nup98	UTSW	7	101,825,596 (GRCm39)	missense	probably benign	0.02
R7646:Nup98	UTSW	7	101,803,242 (GRCm39)	missense	probably benign	0.01
R7648:Nup98	UTSW	7	101,773,404 (GRCm39)	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	101,802,464 (GRCm39)	splice site	probably null
R7827:Nup98	UTSW	7	101,773,569 (GRCm39)	missense	probably benign	0.10
R7884:Nup98	UTSW	7	101,825,556 (GRCm39)	missense	probably benign	0.12
R7943:Nup98	UTSW	7	101,844,029 (GRCm39)	missense	probably benign	0.10
R8034:Nup98	UTSW	7	101,794,930 (GRCm39)	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	101,835,859 (GRCm39)	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	101,783,895 (GRCm39)	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	101,844,173 (GRCm39)	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9148:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9223:Nup98	UTSW	7	101,834,167 (GRCm39)	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9249:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9272:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9274:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9283:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9326:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9466:Nup98	UTSW	7	101,818,611 (GRCm39)	missense	probably benign	0.05
R9492:Nup98	UTSW	7	101,778,252 (GRCm39)	missense	probably benign	0.11
R9661:Nup98	UTSW	7	101,782,019 (GRCm39)	nonsense	probably null
T0970:Nup98	UTSW	7	101,835,959 (GRCm39)	unclassified	probably benign
X0054:Nup98	UTSW	7	101,796,415 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCACAGCTCTTGTAACAAAGTG -3'
(R):5'- TGGACACTGACTTTGTACTTCAG -3'

Sequencing Primer
(F):5'- GAATAGCCCTGACTGTCCTGGAAC -3'
(R):5'- CTTGTGTAGGTCTCCTCTA -3'

Posted On

2018-11-06