Incidental Mutation 'R0881:Nup98'
ID 80544
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Name nucleoporin 98
Synonyms Nup96
MMRRC Submission 039048-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0881 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 101768607-101859359 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101809923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 536 (T536S)
Ref Sequence ENSEMBL: ENSMUSP00000147445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000070165
AA Change: T536S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: T536S

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210682
AA Change: T536S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211005
AA Change: T536S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211022
AA Change: T519S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211235
AA Change: T519S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211764
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abcc9 T A 6: 142,592,029 (GRCm39) I732F probably damaging Het
Adam10 T C 9: 70,653,519 (GRCm39) S248P probably damaging Het
Adam18 A T 8: 25,162,159 (GRCm39) probably benign Het
Angel2 G A 1: 190,669,661 (GRCm39) E114K probably damaging Het
Arhgap29 A G 3: 121,808,328 (GRCm39) T1169A probably damaging Het
Atp13a2 T A 4: 140,731,242 (GRCm39) M759K probably damaging Het
Atxn2l A G 7: 126,095,768 (GRCm39) S450P probably damaging Het
B3glct T A 5: 149,663,034 (GRCm39) V264E probably damaging Het
Bbx A G 16: 50,040,963 (GRCm39) probably benign Het
Bmp3 A G 5: 99,020,461 (GRCm39) N295D possibly damaging Het
C9 G A 15: 6,488,349 (GRCm39) probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Cdan1 A T 2: 120,551,466 (GRCm39) V1039E probably damaging Het
Dennd4a T C 9: 64,758,665 (GRCm39) probably null Het
Ext1 A G 15: 53,207,879 (GRCm39) L294P probably benign Het
Fsip2 C A 2: 82,816,617 (GRCm39) H4117N possibly damaging Het
Itga8 C T 2: 12,267,003 (GRCm39) probably null Het
Itln1 G T 1: 171,360,949 (GRCm39) H48N probably benign Het
Kcna5 T A 6: 126,511,957 (GRCm39) H57L probably benign Het
Klhdc4 A T 8: 122,526,226 (GRCm39) Y304* probably null Het
Klhl25 A G 7: 75,516,027 (GRCm39) Y6C probably damaging Het
Lars1 C T 18: 42,347,851 (GRCm39) V991M probably benign Het
Med20 T C 17: 47,922,605 (GRCm39) M1T probably null Het
Mslnl A T 17: 25,961,939 (GRCm39) H138L possibly damaging Het
Mycbp2 T C 14: 103,457,449 (GRCm39) I1583V probably benign Het
Nipbl A C 15: 8,337,096 (GRCm39) V2093G probably damaging Het
Opalin T C 19: 41,052,420 (GRCm39) probably null Het
Or1j12 T G 2: 36,343,452 (GRCm39) L285R probably damaging Het
Or51d1 T A 7: 102,348,291 (GRCm39) V282D possibly damaging Het
Or8g26 A G 9: 39,095,984 (GRCm39) K170R probably benign Het
Pgm2 A T 5: 64,250,351 (GRCm39) T9S unknown Het
Piwil2 A C 14: 70,646,376 (GRCm39) S387A probably benign Het
Polr1c T C 17: 46,555,539 (GRCm39) T240A possibly damaging Het
Polr3c A G 3: 96,631,163 (GRCm39) M118T probably damaging Het
Pth1r C T 9: 110,560,641 (GRCm39) C42Y probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rictor A T 15: 6,821,151 (GRCm39) M1492L probably benign Het
Rrbp1 T A 2: 143,795,173 (GRCm39) Y1277F probably benign Het
Scgb3a2 T G 18: 43,897,549 (GRCm39) probably benign Het
Skint1 G A 4: 111,886,054 (GRCm39) S327N probably benign Het
Steap4 A T 5: 8,030,388 (GRCm39) S415C probably benign Het
Tex48 A G 4: 63,530,228 (GRCm39) probably benign Het
Tox2 T A 2: 163,163,365 (GRCm39) S502T probably benign Het
Usp47 T A 7: 111,690,643 (GRCm39) I762K possibly damaging Het
Vmn2r53 T C 7: 12,334,859 (GRCm39) H267R probably benign Het
Wnt2b A G 3: 104,860,513 (GRCm39) probably benign Het
Xirp1 T C 9: 119,847,483 (GRCm39) N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 (GRCm39) S550P probably benign Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 101,844,194 (GRCm39) missense probably damaging 1.00
IGL00789:Nup98 APN 7 101,803,178 (GRCm39) missense probably benign
IGL00798:Nup98 APN 7 101,796,411 (GRCm39) missense probably damaging 1.00
IGL01562:Nup98 APN 7 101,835,125 (GRCm39) missense probably damaging 0.99
IGL01942:Nup98 APN 7 101,843,918 (GRCm39) missense probably damaging 1.00
IGL02109:Nup98 APN 7 101,832,693 (GRCm39) missense probably benign 0.37
IGL02490:Nup98 APN 7 101,801,573 (GRCm39) missense probably damaging 1.00
IGL03184:Nup98 APN 7 101,832,752 (GRCm39) missense probably damaging 0.99
PIT4519001:Nup98 UTSW 7 101,784,171 (GRCm39) missense probably benign 0.00
R0040:Nup98 UTSW 7 101,841,241 (GRCm39) missense probably damaging 1.00
R0133:Nup98 UTSW 7 101,788,859 (GRCm39) critical splice acceptor site probably null
R0309:Nup98 UTSW 7 101,801,635 (GRCm39) missense probably null
R0471:Nup98 UTSW 7 101,788,004 (GRCm39) missense probably benign 0.13
R0538:Nup98 UTSW 7 101,835,892 (GRCm39) missense probably damaging 1.00
R0650:Nup98 UTSW 7 101,801,660 (GRCm39) missense probably damaging 1.00
R0730:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R0900:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R1120:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R1159:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R1469:Nup98 UTSW 7 101,788,008 (GRCm39) missense probably benign 0.00
R1469:Nup98 UTSW 7 101,788,008 (GRCm39) missense probably benign 0.00
R1470:Nup98 UTSW 7 101,796,513 (GRCm39) missense probably damaging 0.98
R1470:Nup98 UTSW 7 101,796,513 (GRCm39) missense probably damaging 0.98
R1545:Nup98 UTSW 7 101,784,087 (GRCm39) missense possibly damaging 0.77
R1775:Nup98 UTSW 7 101,784,144 (GRCm39) missense probably benign 0.03
R1889:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R2080:Nup98 UTSW 7 101,829,631 (GRCm39) missense probably damaging 0.96
R3423:Nup98 UTSW 7 101,834,084 (GRCm39) missense probably benign 0.03
R4361:Nup98 UTSW 7 101,794,921 (GRCm39) missense probably damaging 1.00
R4678:Nup98 UTSW 7 101,834,038 (GRCm39) missense probably damaging 1.00
R4864:Nup98 UTSW 7 101,802,403 (GRCm39) missense possibly damaging 0.94
R4910:Nup98 UTSW 7 101,845,007 (GRCm39) missense unknown
R4924:Nup98 UTSW 7 101,784,185 (GRCm39) missense probably damaging 1.00
R5068:Nup98 UTSW 7 101,794,862 (GRCm39) missense probably benign 0.00
R5069:Nup98 UTSW 7 101,794,862 (GRCm39) missense probably benign 0.00
R5233:Nup98 UTSW 7 101,845,029 (GRCm39) missense unknown
R5779:Nup98 UTSW 7 101,801,568 (GRCm39) missense probably benign
R5922:Nup98 UTSW 7 101,803,224 (GRCm39) missense probably damaging 1.00
R6010:Nup98 UTSW 7 101,829,636 (GRCm39) missense probably damaging 1.00
R6039:Nup98 UTSW 7 101,784,002 (GRCm39) missense probably benign
R6039:Nup98 UTSW 7 101,784,002 (GRCm39) missense probably benign
R6343:Nup98 UTSW 7 101,843,957 (GRCm39) missense possibly damaging 0.90
R6364:Nup98 UTSW 7 101,825,522 (GRCm39) missense probably damaging 1.00
R6462:Nup98 UTSW 7 101,844,223 (GRCm39) missense probably benign 0.03
R6577:Nup98 UTSW 7 101,778,053 (GRCm39) splice site probably null
R6900:Nup98 UTSW 7 101,835,169 (GRCm39) missense probably damaging 1.00
R7205:Nup98 UTSW 7 101,844,248 (GRCm39) missense unknown
R7218:Nup98 UTSW 7 101,841,107 (GRCm39) splice site probably null
R7235:Nup98 UTSW 7 101,774,491 (GRCm39) missense probably damaging 1.00
R7307:Nup98 UTSW 7 101,784,002 (GRCm39) missense probably benign
R7402:Nup98 UTSW 7 101,784,144 (GRCm39) missense probably benign 0.00
R7427:Nup98 UTSW 7 101,784,208 (GRCm39) splice site probably null
R7428:Nup98 UTSW 7 101,784,208 (GRCm39) splice site probably null
R7584:Nup98 UTSW 7 101,825,596 (GRCm39) missense probably benign 0.02
R7646:Nup98 UTSW 7 101,803,242 (GRCm39) missense probably benign 0.01
R7648:Nup98 UTSW 7 101,773,404 (GRCm39) missense possibly damaging 0.94
R7742:Nup98 UTSW 7 101,802,464 (GRCm39) splice site probably null
R7827:Nup98 UTSW 7 101,773,569 (GRCm39) missense probably benign 0.10
R7884:Nup98 UTSW 7 101,825,556 (GRCm39) missense probably benign 0.12
R7943:Nup98 UTSW 7 101,844,029 (GRCm39) missense probably benign 0.10
R8034:Nup98 UTSW 7 101,794,930 (GRCm39) critical splice acceptor site probably null
R8952:Nup98 UTSW 7 101,835,859 (GRCm39) missense probably damaging 1.00
R9060:Nup98 UTSW 7 101,783,895 (GRCm39) missense probably damaging 1.00
R9099:Nup98 UTSW 7 101,844,173 (GRCm39) missense probably damaging 0.98
R9146:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9148:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9223:Nup98 UTSW 7 101,834,167 (GRCm39) missense possibly damaging 0.82
R9246:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9249:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9272:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9274:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9283:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9326:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9466:Nup98 UTSW 7 101,818,611 (GRCm39) missense probably benign 0.05
R9492:Nup98 UTSW 7 101,778,252 (GRCm39) missense probably benign 0.11
R9661:Nup98 UTSW 7 101,782,019 (GRCm39) nonsense probably null
T0970:Nup98 UTSW 7 101,835,959 (GRCm39) unclassified probably benign
X0054:Nup98 UTSW 7 101,796,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTAGGCATGAATGCTCCGTTG -3'
(R):5'- TGGTAAGATGTGAGTCACTGGCCC -3'

Sequencing Primer
(F):5'- AATGCTCCGTTGGCTAGAG -3'
(R):5'- TTGCTAAATAGACATGGCAGGTC -3'
Posted On 2013-11-07