Incidental Mutation 'R1889:Nup98'
ID209827
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Namenucleoporin 98
SynonymsNup96
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102119398-102210176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102160716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 536 (T536S)
Ref Sequence ENSEMBL: ENSMUSP00000147445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]
Predicted Effect probably damaging
Transcript: ENSMUST00000070165
AA Change: T536S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: T536S

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210682
AA Change: T536S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211005
AA Change: T536S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211022
AA Change: T519S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211235
AA Change: T519S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211764
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 102194987 missense probably damaging 1.00
IGL00789:Nup98 APN 7 102153971 missense probably benign
IGL00798:Nup98 APN 7 102147204 missense probably damaging 1.00
IGL01562:Nup98 APN 7 102185918 missense probably damaging 0.99
IGL01942:Nup98 APN 7 102194711 missense probably damaging 1.00
IGL02109:Nup98 APN 7 102183486 missense probably benign 0.37
IGL02490:Nup98 APN 7 102152366 missense probably damaging 1.00
IGL03184:Nup98 APN 7 102183545 missense probably damaging 0.99
R0040:Nup98 UTSW 7 102192034 missense probably damaging 1.00
R0133:Nup98 UTSW 7 102139652 critical splice acceptor site probably null
R0309:Nup98 UTSW 7 102152428 missense probably null
R0471:Nup98 UTSW 7 102138797 missense probably benign 0.13
R0538:Nup98 UTSW 7 102186685 missense probably damaging 1.00
R0650:Nup98 UTSW 7 102152453 missense probably damaging 1.00
R0730:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0881:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0900:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1120:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1159:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1545:Nup98 UTSW 7 102134880 missense possibly damaging 0.77
R1775:Nup98 UTSW 7 102134937 missense probably benign 0.03
R2080:Nup98 UTSW 7 102180424 missense probably damaging 0.96
R3423:Nup98 UTSW 7 102184877 missense probably benign 0.03
R4361:Nup98 UTSW 7 102145714 missense probably damaging 1.00
R4678:Nup98 UTSW 7 102184831 missense probably damaging 1.00
R4864:Nup98 UTSW 7 102153196 missense possibly damaging 0.94
R4910:Nup98 UTSW 7 102195800 missense unknown
R4924:Nup98 UTSW 7 102134978 missense probably damaging 1.00
R5068:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5069:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5233:Nup98 UTSW 7 102195822 missense unknown
R5779:Nup98 UTSW 7 102152361 missense probably benign
R5922:Nup98 UTSW 7 102154017 missense probably damaging 1.00
R6010:Nup98 UTSW 7 102180429 missense probably damaging 1.00
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6343:Nup98 UTSW 7 102194750 missense possibly damaging 0.90
R6364:Nup98 UTSW 7 102176315 missense probably damaging 1.00
R6462:Nup98 UTSW 7 102195016 missense probably benign 0.03
R6577:Nup98 UTSW 7 102128846 intron probably null
R6900:Nup98 UTSW 7 102185962 missense probably damaging 1.00
T0970:Nup98 UTSW 7 102186752 unclassified probably benign
X0054:Nup98 UTSW 7 102147208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATGCTCCGTTGGCTAG -3'
(R):5'- AAGATGTGAGTCACTGGCC -3'

Sequencing Primer
(F):5'- AGAGATGGTTCATCGTCATCCAGC -3'
(R):5'- CCTTGCTAAATAGACATGGCAGGTC -3'
Posted On2014-06-30