Incidental Mutation 'R6499:Chrm5'
ID 519613
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Name cholinergic receptor, muscarinic 5
Synonyms muscarinic acetylcholine receptor 5, M5R
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 112309516-112311114 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112310825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 97 (V97D)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
AlphaFold Q920H4
Predicted Effect probably benign
Transcript: ENSMUST00000099589
AA Change: V97D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: V97D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112,309,577 (GRCm39) missense probably benign
IGL01611:Chrm5 APN 2 112,310,651 (GRCm39) nonsense probably null
IGL02152:Chrm5 APN 2 112,310,913 (GRCm39) missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112,310,706 (GRCm39) missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112,310,556 (GRCm39) missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112,311,065 (GRCm39) missense probably benign
R0432:Chrm5 UTSW 2 112,310,000 (GRCm39) missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112,310,214 (GRCm39) missense probably benign 0.00
R1611:Chrm5 UTSW 2 112,309,532 (GRCm39) missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112,310,182 (GRCm39) missense probably benign 0.00
R1693:Chrm5 UTSW 2 112,309,625 (GRCm39) missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112,310,597 (GRCm39) missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112,310,597 (GRCm39) missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112,309,572 (GRCm39) missense probably null 0.93
R2890:Chrm5 UTSW 2 112,310,048 (GRCm39) missense probably benign 0.00
R4659:Chrm5 UTSW 2 112,310,102 (GRCm39) missense probably benign
R4785:Chrm5 UTSW 2 112,309,930 (GRCm39) missense probably benign 0.25
R5196:Chrm5 UTSW 2 112,310,729 (GRCm39) missense probably damaging 1.00
R5734:Chrm5 UTSW 2 112,310,445 (GRCm39) missense probably benign 0.28
R6343:Chrm5 UTSW 2 112,309,793 (GRCm39) missense probably damaging 1.00
R6672:Chrm5 UTSW 2 112,310,141 (GRCm39) missense probably benign
R6905:Chrm5 UTSW 2 112,309,901 (GRCm39) missense probably benign 0.00
R7192:Chrm5 UTSW 2 112,310,672 (GRCm39) missense probably damaging 0.97
R7775:Chrm5 UTSW 2 112,310,301 (GRCm39) missense probably benign 0.07
R7778:Chrm5 UTSW 2 112,310,301 (GRCm39) missense probably benign 0.07
R8780:Chrm5 UTSW 2 112,310,453 (GRCm39) missense possibly damaging 0.64
R9287:Chrm5 UTSW 2 112,309,610 (GRCm39) missense probably damaging 1.00
R9436:Chrm5 UTSW 2 112,309,824 (GRCm39) missense possibly damaging 0.69
R9502:Chrm5 UTSW 2 112,311,040 (GRCm39) missense probably damaging 1.00
X0023:Chrm5 UTSW 2 112,310,826 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAAGCCGATCATGATGC -3'
(R):5'- TTTGGAACGCCATGGACTGTG -3'

Sequencing Primer
(F):5'- GATCATGATGCCAGCCCTC -3'
(R):5'- ACTATTGCAGCTGTGACCG -3'
Posted On 2018-06-06