Incidental Mutation 'R5734:Chrm5'
ID451573
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Namecholinergic receptor, muscarinic 5
SynonymsM5R, muscarinic acetylcholine receptor 5
MMRRC Submission 043348-MU
Accession Numbers

Genbank: NM_205783; MGI: 109248

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112479171-112480769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112480100 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 224 (T224S)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
Predicted Effect probably benign
Transcript: ENSMUST00000099589
AA Change: T224S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: T224S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112479232 missense probably benign
IGL01611:Chrm5 APN 2 112480306 nonsense probably null
IGL02152:Chrm5 APN 2 112480568 missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112480361 missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112480211 missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112480720 missense probably benign
R0432:Chrm5 UTSW 2 112479655 missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112479869 missense probably benign 0.00
R1611:Chrm5 UTSW 2 112479187 missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112479837 missense probably benign 0.00
R1693:Chrm5 UTSW 2 112479280 missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112479227 missense probably null 0.93
R2890:Chrm5 UTSW 2 112479703 missense probably benign 0.00
R4659:Chrm5 UTSW 2 112479757 missense probably benign
R4785:Chrm5 UTSW 2 112479585 missense probably benign 0.25
R5196:Chrm5 UTSW 2 112480384 missense probably damaging 1.00
R6343:Chrm5 UTSW 2 112479448 missense probably damaging 1.00
R6499:Chrm5 UTSW 2 112480480 missense probably benign
R6672:Chrm5 UTSW 2 112479796 missense probably benign
R6905:Chrm5 UTSW 2 112479556 missense probably benign 0.00
R7192:Chrm5 UTSW 2 112480327 missense probably damaging 0.97
X0023:Chrm5 UTSW 2 112480481 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTTGGTAACCTGCTCAGC -3'
(R):5'- TCTGCTGGCAGTACTTGGTC -3'

Sequencing Primer
(F):5'- TCAGCACTTAGATCAGTGGC -3'
(R):5'- CAGTACTTGGTCGGGAAGC -3'
Posted On2017-01-03