Incidental Mutation 'R6456:Wdr78'
ID520155
Institutional Source Beutler Lab
Gene Symbol Wdr78
Ensembl Gene ENSMUSG00000035126
Gene NameWD repeat domain 78
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location103038065-103114555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103049549 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 689 (M689R)
Ref Sequence ENSEMBL: ENSMUSP00000102481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036451] [ENSMUST00000036557] [ENSMUST00000106868] [ENSMUST00000116316]
Predicted Effect probably benign
Transcript: ENSMUST00000036451
SMART Domains Protein: ENSMUSP00000037588
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036557
SMART Domains Protein: ENSMUSP00000042272
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 59 67 N/A INTRINSIC
low complexity region 76 100 N/A INTRINSIC
WD40 133 172 9.24e-4 SMART
WD40 182 229 5.7e1 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 262 296 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106868
AA Change: M689R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102481
Gene: ENSMUSG00000035126
AA Change: M689R

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 8.61e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
low complexity region 601 613 N/A INTRINSIC
Blast:WD40 614 648 3e-12 BLAST
WD40 652 692 2.38e-6 SMART
WD40 695 734 1.48e-2 SMART
WD40 739 779 6.14e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116316
SMART Domains Protein: ENSMUSP00000112018
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138960
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Other mutations in Wdr78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Wdr78 APN 4 103103242 missense possibly damaging 0.77
IGL01508:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01509:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01511:Wdr78 APN 4 103048361 missense possibly damaging 0.81
IGL01693:Wdr78 APN 4 103087330 splice site probably null
IGL01731:Wdr78 APN 4 103062435 missense probably benign 0.01
IGL02033:Wdr78 APN 4 103066293 missense possibly damaging 0.58
IGL02100:Wdr78 APN 4 103050149 missense probably damaging 1.00
IGL02218:Wdr78 APN 4 103096774 missense probably damaging 1.00
IGL02226:Wdr78 APN 4 103090398 missense probably benign 0.00
IGL02476:Wdr78 APN 4 103087348 missense possibly damaging 0.46
IGL02929:Wdr78 APN 4 103059991 nonsense probably null
R0070:Wdr78 UTSW 4 103059934 missense probably damaging 1.00
R0377:Wdr78 UTSW 4 103048259 missense probably damaging 1.00
R0433:Wdr78 UTSW 4 103103253 missense probably benign 0.41
R0518:Wdr78 UTSW 4 103064530 nonsense probably null
R0538:Wdr78 UTSW 4 103096618 missense possibly damaging 0.65
R0624:Wdr78 UTSW 4 103072857 splice site probably benign
R0894:Wdr78 UTSW 4 103049386 intron probably benign
R1463:Wdr78 UTSW 4 103087418 missense possibly damaging 0.95
R1818:Wdr78 UTSW 4 103072657 missense possibly damaging 0.67
R2073:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2075:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2436:Wdr78 UTSW 4 103066352 missense probably benign 0.01
R2851:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2852:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2853:Wdr78 UTSW 4 103050158 missense possibly damaging 0.90
R4491:Wdr78 UTSW 4 103066399 missense probably benign 0.04
R4792:Wdr78 UTSW 4 103072684 missense possibly damaging 0.94
R5223:Wdr78 UTSW 4 103049403 missense possibly damaging 0.87
R5290:Wdr78 UTSW 4 103049533 missense probably benign 0.00
R5465:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R5975:Wdr78 UTSW 4 103049589 missense probably benign 0.03
R6239:Wdr78 UTSW 4 103066443 missense probably benign
R6304:Wdr78 UTSW 4 103087356 missense probably benign 0.35
R6467:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R6813:Wdr78 UTSW 4 103048326 missense probably benign 0.26
R7161:Wdr78 UTSW 4 103096616 missense probably benign 0.28
R7198:Wdr78 UTSW 4 103062413 missense probably damaging 0.98
R7208:Wdr78 UTSW 4 103066352 missense probably benign 0.00
R7320:Wdr78 UTSW 4 103050187 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCTGTTTCTCCTGGAGACATCAC -3'
(R):5'- ATGCAATGCTCAGTGGTGC -3'

Sequencing Primer
(F):5'- TTTCTCCTGGAGACATCACTCAAAAC -3'
(R):5'- GTGCATGTGTAGCTTCTAGAAATC -3'
Posted On2018-06-06