Incidental Mutation 'R6469:1110002E22Rik'
ID520248
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6469 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 138066975 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 642 (S642A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: S642A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: S642A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.3%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 60,024,789 T242S probably benign Het
Adprh T C 16: 38,450,309 M45V probably benign Het
Akr1c13 T C 13: 4,196,512 probably null Het
Ap3d1 A C 10: 80,712,158 V900G probably benign Het
Bak1 G A 17: 27,021,319 R125C probably damaging Het
Bmpr1b T C 3: 141,856,461 T322A possibly damaging Het
Camsap3 T A 8: 3,603,941 L521Q possibly damaging Het
Col6a6 A T 9: 105,698,691 F2157I probably damaging Het
Dcun1d4 G A 5: 73,534,614 M155I probably damaging Het
Diaph3 T C 14: 86,656,538 S12G possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgb A T 3: 83,046,142 L107* probably null Het
Ganab T C 19: 8,902,632 probably null Het
Gba C T 3: 89,204,081 P51L probably benign Het
Glb1l2 T C 9: 26,796,532 D60G probably benign Het
Gm20767 T A 13: 120,154,813 W63R probably damaging Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Itih2 A G 2: 10,123,413 V159A possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lrch1 C T 14: 74,817,085 R323Q probably damaging Het
Lrrc30 T C 17: 67,631,865 N240S probably benign Het
Mrgpra9 T C 7: 47,235,106 Y271C probably benign Het
Ncor1 T C 11: 62,343,302 H682R probably damaging Het
Olfr115 A T 17: 37,610,313 V146E probably damaging Het
Pax9 C A 12: 56,696,863 F98L probably damaging Het
Phlpp1 G A 1: 106,287,103 R585Q probably damaging Het
Prkdc A G 16: 15,795,075 T3166A probably benign Het
Prr11 T A 11: 87,097,177 Q300L possibly damaging Het
Rad50 T A 11: 53,684,235 E620D probably benign Het
Rpl3 A T 15: 80,083,345 probably null Het
Sacs G T 14: 61,191,248 G252V probably damaging Het
Serpina3i T A 12: 104,266,517 V227E probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snx19 T C 9: 30,427,743 V59A possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tsc1 G A 2: 28,671,886 probably null Het
Vmn2r61 C T 7: 42,265,859 Q77* probably null Het
Wdr72 A G 9: 74,213,361 H954R probably benign Het
Zbtb21 T C 16: 97,956,772 M20V probably benign Het
Zkscan16 A T 4: 58,956,483 D255V probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAGGACCATGCAAAG -3'
(R):5'- TTTGCTGACCACAAACTCCAAG -3'

Sequencing Primer
(F):5'- CAAAGAAATTCATTGCTGTCCCTGC -3'
(R):5'- AAGGCCTTGGTCTGCGACTTC -3'
Posted On2018-06-06