Incidental Mutation 'R6556:Spag1'
ID522202
Institutional Source Beutler Lab
Gene Symbol Spag1
Ensembl Gene ENSMUSG00000037617
Gene Namesperm associated antigen 1
Synonymstpis, TPR-containing protein involved in spermatogenesis
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location36178099-36235621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36195407 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 249 (Y249H)
Ref Sequence ENSEMBL: ENSMUSP00000132233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047348] [ENSMUST00000171205]
Predicted Effect probably damaging
Transcript: ENSMUST00000047348
AA Change: Y249H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047335
Gene: ENSMUSG00000037617
AA Change: Y249H

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171205
AA Change: Y249H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132233
Gene: ENSMUSG00000037617
AA Change: Y249H

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Spag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Spag1 APN 15 36195416 nonsense probably null
IGL00465:Spag1 APN 15 36183821 unclassified probably benign
IGL00694:Spag1 APN 15 36227171 missense possibly damaging 0.94
IGL01479:Spag1 APN 15 36233199 splice site probably benign
IGL01830:Spag1 APN 15 36221559 missense probably benign 0.01
IGL02072:Spag1 APN 15 36190512 missense probably damaging 1.00
IGL02232:Spag1 APN 15 36221564 missense probably benign 0.00
IGL02727:Spag1 APN 15 36234818 missense probably damaging 1.00
IGL02810:Spag1 APN 15 36234547 missense probably damaging 1.00
IGL03010:Spag1 APN 15 36233273 missense probably benign 0.15
IGL03069:Spag1 APN 15 36224099 splice site probably benign
IGL03244:Spag1 APN 15 36234383 missense probably benign 0.00
FR4737:Spag1 UTSW 15 36197733 critical splice acceptor site probably benign
R0863:Spag1 UTSW 15 36192047 missense probably damaging 1.00
R1177:Spag1 UTSW 15 36234767 missense probably benign 0.21
R1878:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R1879:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R2086:Spag1 UTSW 15 36227141 missense probably damaging 0.98
R2093:Spag1 UTSW 15 36224130 missense probably damaging 1.00
R2231:Spag1 UTSW 15 36191167 missense probably benign 0.01
R4030:Spag1 UTSW 15 36234301 missense probably damaging 0.99
R4893:Spag1 UTSW 15 36197846 critical splice donor site probably null
R5047:Spag1 UTSW 15 36195442 missense probably damaging 1.00
R5505:Spag1 UTSW 15 36234626 missense probably damaging 0.99
R5741:Spag1 UTSW 15 36183703 missense possibly damaging 0.79
R5805:Spag1 UTSW 15 36200284 missense probably damaging 1.00
R6221:Spag1 UTSW 15 36197803 missense probably benign 0.30
R6236:Spag1 UTSW 15 36211135 missense probably damaging 1.00
R6800:Spag1 UTSW 15 36197749 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTCTGATGTTTGCAGAG -3'
(R):5'- GCAGTTTACAGTGTTCCCCAC -3'

Sequencing Primer
(F):5'- GATGTTTGCAGAGCCCCTCAC -3'
(R):5'- ACAGTCCATCATGGTCATGG -3'
Posted On2018-06-06