Incidental Mutation 'R6489:Pde4dip'
ID522616
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6489 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 97755591 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 521 (R521*)
Ref Sequence ENSEMBL: ENSMUSP00000131170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]
Predicted Effect probably null
Transcript: ENSMUST00000045243
AA Change: R564*
SMART Domains Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: R564*

DomainStartEndE-ValueType
low complexity region 72 90 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
SCOP:d1gw5a_ 613 839 3e-3 SMART
coiled coil region 909 985 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090750
AA Change: R521*
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: R521*

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107038
AA Change: R467*
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170
AA Change: R467*

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000168438
AA Change: R521*
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: R521*

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175751
SMART Domains Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
Pfam:zf-AD 4 78 4.3e-8 PFAM
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
coiled coil region 513 538 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.3%
  • 20x: 90.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,010,319 T650A probably benign Het
Alkbh7 T A 17: 56,998,979 S127T probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
App G T 16: 85,056,520 D223E unknown Het
Arhgef2 C A 3: 88,643,014 S675R probably damaging Het
Atg14 T C 14: 47,549,023 D258G probably damaging Het
Ckap2l T C 2: 129,269,114 D721G possibly damaging Het
Cog8 T C 8: 107,050,301 T481A probably benign Het
Colec10 C A 15: 54,462,213 probably null Het
Dhx9 T C 1: 153,456,643 probably benign Het
Dock1 T C 7: 134,990,541 M935T probably damaging Het
Dsg4 T A 18: 20,471,363 N962K possibly damaging Het
Dym T C 18: 75,080,226 V173A probably benign Het
Exoc3l4 A G 12: 111,428,697 Y583C probably damaging Het
Fam26e A T 10: 34,092,506 W184R probably damaging Het
Flnb G A 14: 7,867,551 V103M probably damaging Het
Fzd1 T A 5: 4,757,336 Q82L probably benign Het
Gabrr1 A G 4: 33,162,855 I474V probably benign Het
Galnt11 G T 5: 25,264,966 W521L probably damaging Het
Glb1l3 A G 9: 26,826,831 V420A probably benign Het
Gm5678 A T 16: 93,630,398 probably null Het
H1fnt A T 15: 98,257,007 L87* probably null Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Ihh T A 1: 74,946,511 T272S probably damaging Het
Il27ra T C 8: 84,031,550 M524V probably benign Het
Lman1l A T 9: 57,613,726 probably null Het
Mdp1 C A 14: 55,660,391 probably benign Het
Med12l A G 3: 59,257,407 K1436R probably damaging Het
Megf10 C T 18: 57,291,807 S1006F probably benign Het
Miga1 A T 3: 152,279,008 I426N probably damaging Het
Mtmr6 C T 14: 60,300,514 T654I possibly damaging Het
Nbeal1 A G 1: 60,330,942 S2673G possibly damaging Het
Nup93 T A 8: 94,302,088 H193Q probably benign Het
Olfr1303 A C 2: 111,814,060 L222W probably damaging Het
Olfr384 T A 11: 73,603,439 N286K probably damaging Het
Olfr629 T C 7: 103,740,668 N191D probably benign Het
Pdcd11 C T 19: 47,109,752 R826C probably damaging Het
Phf2 T C 13: 48,826,182 S158G unknown Het
Pla2g15 A G 8: 106,163,194 E366G probably benign Het
Plekhm2 A T 4: 141,632,033 H494Q probably damaging Het
Prpsap2 A T 11: 61,749,064 M87K probably damaging Het
Rbm19 T G 5: 120,120,130 S137A probably benign Het
Ryr2 T A 13: 11,834,007 I363L probably benign Het
Samd9l T C 6: 3,376,896 T122A probably benign Het
Scn4a G C 11: 106,349,180 D70E probably benign Het
Slc12a3 T A 8: 94,335,004 V293D possibly damaging Het
Slc6a7 T C 18: 61,007,543 Y139C probably damaging Het
Slco2b1 A T 7: 99,690,555 C9* probably null Het
Slitrk1 A T 14: 108,911,303 S659T possibly damaging Het
Son T G 16: 91,655,156 S264A possibly damaging Het
Svep1 C A 4: 58,100,066 G1326V probably damaging Het
Tcf12 A G 9: 72,015,636 probably null Het
Ttn A G 2: 76,814,718 V11185A probably damaging Het
Ubap2 T C 4: 41,203,574 probably null Het
Utp15 G T 13: 98,250,609 F434L probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vsnl1 T G 12: 11,332,218 probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb34 A C 2: 33,411,546 S328A probably damaging Het
Zdbf2 T C 1: 63,307,478 I1672T possibly damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTTTCGTCGAGGACTCAC -3'
(R):5'- ACATGATGGTATTCTCTGCTACC -3'

Sequencing Primer
(F):5'- GGACTCACCTGAATTAGCTGC -3'
(R):5'- AGGAGCTATGTTGCCCAGG -3'
Posted On2018-06-06