Incidental Mutation 'R6579:Adam15'
ID523912
Institutional Source Beutler Lab
Gene Symbol Adam15
Ensembl Gene ENSMUSG00000028041
Gene Namea disintegrin and metallopeptidase domain 15 (metargidin)
SynonymsMDC15, metargidin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6579 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89338542-89349996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89345629 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 261 (V261M)
Ref Sequence ENSEMBL: ENSMUSP00000139147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000070820] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]
Predicted Effect probably damaging
Transcript: ENSMUST00000029676
AA Change: V261M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041
AA Change: V261M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 158 1.2e-14 PFAM
Pfam:Reprolysin_3 208 360 1e-12 PFAM
Pfam:Reprolysin_5 212 394 1.5e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 416 1.6e-54 PFAM
Pfam:Reprolysin_2 257 405 9.9e-12 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070820
SMART Domains Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672

DomainStartEndE-ValueType
coiled coil region 18 44 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 108 125 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
Pfam:DC_STAMP 431 621 1.5e-55 PFAM
Blast:RING 672 710 3e-17 BLAST
SCOP:d1ldjb_ 672 710 2e-3 SMART
low complexity region 717 728 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074582
AA Change: V261M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041
AA Change: V261M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.6e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 2.9e-8 PFAM
Pfam:Reprolysin 214 415 4.2e-56 PFAM
Pfam:Reprolysin_3 238 360 1.7e-14 PFAM
Pfam:Reprolysin_2 254 405 1.1e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 760 813 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107446
AA Change: V261M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041
AA Change: V261M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 9.9e-22 PFAM
Pfam:Reprolysin_3 209 360 5.9e-15 PFAM
Pfam:Reprolysin_5 212 394 5e-16 PFAM
Pfam:Reprolysin_4 213 410 1e-8 PFAM
Pfam:Reprolysin 214 415 1.4e-56 PFAM
Pfam:Reprolysin_2 253 405 4e-11 PFAM
low complexity region 416 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107448
AA Change: V261M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041
AA Change: V261M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.7e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 3e-8 PFAM
Pfam:Reprolysin 214 415 4.4e-56 PFAM
Pfam:Reprolysin_3 238 360 1.8e-14 PFAM
Pfam:Reprolysin_2 254 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 783 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180791
Predicted Effect probably damaging
Transcript: ENSMUST00000184651
AA Change: V261M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041
AA Change: V261M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.9e-21 PFAM
Pfam:Reprolysin_5 212 394 1.7e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 415 4.6e-56 PFAM
Pfam:Reprolysin_3 238 360 1.9e-14 PFAM
Pfam:Reprolysin_2 255 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is prominently expressed in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of hippocampus and cerebellum. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein have increased bone mass resulting from osteoblast proliferation, and exhibit reduced neovascularization in a mouse model for retinopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice develop normally and exhibit normal angiogenesis, but show a resistance to pathological neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,224 V80D possibly damaging Het
6330409D20Rik T C 2: 32,740,651 probably benign Het
Adam29 G T 8: 55,872,744 T225K probably damaging Het
Ankrd52 A G 10: 128,387,142 T654A probably damaging Het
AU021092 T A 16: 5,222,156 I35F probably damaging Het
Casc1 A T 6: 145,179,018 M527K probably benign Het
Cdk20 G T 13: 64,436,534 Q114H probably benign Het
Col22a1 A C 15: 71,881,653 S133A probably benign Het
Cyp3a44 A T 5: 145,790,706 F271Y probably damaging Het
Dchs1 A T 7: 105,762,913 V1332E probably benign Het
Dnajc5 A G 2: 181,547,416 N62D possibly damaging Het
Fam126a A T 5: 23,966,383 V347D possibly damaging Het
Gm3045 C T 13: 56,430,290 S180L probably damaging Het
Gm4756 A T 12: 72,621,884 D117E probably benign Het
Igkv14-130 T A 6: 67,791,437 Y93* probably null Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Olfr262 C T 19: 12,241,362 V100I probably benign Het
Peli1 A T 11: 21,147,059 T150S probably benign Het
Pkhd1 T C 1: 20,200,823 T3169A probably benign Het
Polr2m T A 9: 71,485,720 E26V probably damaging Het
Rhbdf2 A G 11: 116,604,463 V238A probably benign Het
Rims1 G T 1: 22,425,916 P820H probably damaging Het
Rnf213 A G 11: 119,436,280 T1698A probably damaging Het
Scgn C T 13: 23,959,734 A216T probably damaging Het
Serpina11 T A 12: 103,984,748 D238V probably damaging Het
Setd2 A T 9: 110,549,778 E887V possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trak1 C A 9: 121,443,638 N197K probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Uchl5 T A 1: 143,798,392 Y211N probably damaging Het
Usf3 T A 16: 44,218,834 S1226T possibly damaging Het
Utrn T C 10: 12,748,006 T163A probably benign Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zcchc14 T C 8: 121,604,467 probably benign Het
Other mutations in Adam15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Adam15 APN 3 89344138 missense probably benign 0.03
IGL01994:Adam15 APN 3 89341505 splice site probably benign
IGL02184:Adam15 APN 3 89345934 splice site probably benign
IGL02501:Adam15 APN 3 89340462 missense possibly damaging 0.82
IGL02821:Adam15 APN 3 89345356 missense probably damaging 1.00
IGL02933:Adam15 APN 3 89343483 missense possibly damaging 0.91
IGL03078:Adam15 APN 3 89345937 splice site probably benign
IGL03185:Adam15 APN 3 89347905 missense probably benign 0.41
PIT4280001:Adam15 UTSW 3 89343978 critical splice acceptor site probably null
PIT4581001:Adam15 UTSW 3 89343832 missense probably benign 0.00
R0559:Adam15 UTSW 3 89343778 missense probably damaging 1.00
R1530:Adam15 UTSW 3 89349830 missense probably damaging 0.99
R1670:Adam15 UTSW 3 89348510 splice site probably benign
R1909:Adam15 UTSW 3 89345330 missense probably benign 0.19
R3110:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3112:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3897:Adam15 UTSW 3 89346938 missense probably benign 0.00
R4058:Adam15 UTSW 3 89347055 missense possibly damaging 0.94
R4573:Adam15 UTSW 3 89345986 missense probably damaging 1.00
R5267:Adam15 UTSW 3 89349899 utr 5 prime probably benign
R5364:Adam15 UTSW 3 89345595 missense probably damaging 1.00
R5801:Adam15 UTSW 3 89342361 missense probably damaging 1.00
R5813:Adam15 UTSW 3 89345828 missense probably benign 0.12
R5964:Adam15 UTSW 3 89343567 nonsense probably null
R6218:Adam15 UTSW 3 89343883 missense probably benign 0.00
R6564:Adam15 UTSW 3 89347212 missense possibly damaging 0.56
R6834:Adam15 UTSW 3 89340083 missense probably damaging 0.96
R7131:Adam15 UTSW 3 89346980 missense possibly damaging 0.64
R7204:Adam15 UTSW 3 89346937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCATTGTCAGAGCCTCACG -3'
(R):5'- ACACTAGAAGCGGCTCTCTTG -3'

Sequencing Primer
(F):5'- TCAGCCGTGACAGGATAGCATC -3'
(R):5'- TAGAAGCGGCTCTCTTGCTAGAC -3'
Posted On2018-06-22