Incidental Mutation 'R6618:Hells'
ID524247
Institutional Source Beutler Lab
Gene Symbol Hells
Ensembl Gene ENSMUSG00000025001
Gene Namehelicase, lymphoid specific
SynonymsYFK8, LSH, proliferation-associated SNF2-like, PASG, Lysh, E130115I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6618 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location38930915-38971051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38957084 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 589 (R589L)
Ref Sequence ENSEMBL: ENSMUSP00000025965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025965]
Predicted Effect probably benign
Transcript: ENSMUST00000025965
AA Change: R589L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025965
Gene: ENSMUSG00000025001
AA Change: R589L

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Blast:DEXDc 40 144 4e-22 BLAST
DEXDc 202 394 7.04e-31 SMART
HELICc 612 695 5.6e-25 SMART
low complexity region 775 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155465
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show DNA hypomethylation, delayed growth, multiorgan and skeletal defects, premature graying, alopecia, low fat deposition, kyphosis, cachexia and early death. Homozygotes for another null allele show neonatal death, low birth weight, lymphoid defects and renal lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Hells
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02416:Hells APN 19 38964627 missense probably benign
IGL02639:Hells APN 19 38938429 missense probably damaging 0.99
cerberus UTSW 19 38954800 missense probably benign 0.00
charon UTSW 19 38954810 missense probably benign 0.15
intentions UTSW 19 38957199 missense probably damaging 1.00
purgatory UTSW 19 38940635 missense probably benign 0.08
R0543:Hells UTSW 19 38967750 missense probably benign
R1432:Hells UTSW 19 38957184 splice site probably null
R1515:Hells UTSW 19 38967765 missense probably damaging 1.00
R1646:Hells UTSW 19 38967783 missense probably benign 0.19
R1779:Hells UTSW 19 38946842 missense probably benign 0.43
R1851:Hells UTSW 19 38959676 missense probably null 1.00
R1897:Hells UTSW 19 38940484 missense probably benign
R2040:Hells UTSW 19 38955030 missense probably damaging 0.98
R2571:Hells UTSW 19 38959733 missense possibly damaging 0.67
R4475:Hells UTSW 19 38945529 missense probably damaging 1.00
R4763:Hells UTSW 19 38957199 missense probably damaging 1.00
R4948:Hells UTSW 19 38935522 missense probably damaging 1.00
R5087:Hells UTSW 19 38943745 missense probably benign
R5517:Hells UTSW 19 38954800 missense probably benign 0.00
R5538:Hells UTSW 19 38953652 missense probably benign 0.00
R6107:Hells UTSW 19 38953649 missense probably benign 0.00
R6337:Hells UTSW 19 38954810 missense probably benign 0.15
R6577:Hells UTSW 19 38931465 nonsense probably null
R6647:Hells UTSW 19 38931504 missense probably benign 0.01
R6869:Hells UTSW 19 38940635 missense probably benign 0.08
R7471:Hells UTSW 19 38957057 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTTGTAGGAAATGTGAATCATGT -3'
(R):5'- CATCAAGTCTGCTAAAGATGAAGTT -3'

Sequencing Primer
(F):5'- TACCAGCACTCCTATTGGGAAATAG -3'
(R):5'- GCTAAAGATGAAGTTTCTAAGATGGC -3'
Posted On2018-06-22