Incidental Mutation 'R6629:Gnrhr'
ID524974
Institutional Source Beutler Lab
Gene Symbol Gnrhr
Ensembl Gene ENSMUSG00000029255
Gene Namegonadotropin releasing hormone receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6629 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86180754-86197901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86182309 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 284 (V284A)
Ref Sequence ENSEMBL: ENSMUSP00000031172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031172] [ENSMUST00000094654] [ENSMUST00000113372]
Predicted Effect probably benign
Transcript: ENSMUST00000031172
AA Change: V284A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031172
Gene: ENSMUSG00000029255
AA Change: V284A

DomainStartEndE-ValueType
Pfam:7tm_1 63 322 2.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094654
SMART Domains Protein: ENSMUSP00000092238
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 62 261 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113372
SMART Domains Protein: ENSMUSP00000108999
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 60 177 4.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display prepubescent internal reproductive tracts with hypogonadism and hypogonadotrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,780 S219P possibly damaging Het
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Dlgap2 A G 8: 14,831,465 T846A probably benign Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,841,267 probably benign Het
Nek1 A G 8: 61,054,333 probably null Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rsbn1 A C 3: 103,928,441 D265A probably damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Tspear A T 10: 77,870,509 H371L probably benign Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in Gnrhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gnrhr APN 5 86197303 critical splice donor site probably null
IGL01432:Gnrhr APN 5 86182193 missense probably damaging 1.00
IGL02702:Gnrhr APN 5 86182269 missense possibly damaging 0.69
IGL03367:Gnrhr APN 5 86182331 missense probably benign 0.02
R0483:Gnrhr UTSW 5 86197575 missense probably damaging 1.00
R1873:Gnrhr UTSW 5 86182201 missense probably damaging 1.00
R2199:Gnrhr UTSW 5 86197818 missense probably benign 0.26
R2303:Gnrhr UTSW 5 86197749 missense probably benign 0.01
R4400:Gnrhr UTSW 5 86182249 unclassified probably null
R5273:Gnrhr UTSW 5 86182246 missense possibly damaging 0.86
R5320:Gnrhr UTSW 5 86197614 missense possibly damaging 0.95
R6159:Gnrhr UTSW 5 86182357 missense probably damaging 1.00
R6221:Gnrhr UTSW 5 86185403 nonsense probably null
R6725:Gnrhr UTSW 5 86185313 missense probably damaging 0.97
X0018:Gnrhr UTSW 5 86197755 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCCTGCCTTGTATATAAGTGTGTC -3'
(R):5'- CAGCTTTATTACATAGCCCAGGC -3'

Sequencing Primer
(F):5'- GCCTTGTATATAAGTGTGTCAAAAGC -3'
(R):5'- GCTAAAGATGACAGTCGC -3'
Posted On2018-06-22