Incidental Mutation 'R1873:Gnrhr'
ID210924
Institutional Source Beutler Lab
Gene Symbol Gnrhr
Ensembl Gene ENSMUSG00000029255
Gene Namegonadotropin releasing hormone receptor
Synonyms
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86180754-86197901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86182201 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 320 (L320P)
Ref Sequence ENSEMBL: ENSMUSP00000031172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031172] [ENSMUST00000094654] [ENSMUST00000113372]
Predicted Effect probably damaging
Transcript: ENSMUST00000031172
AA Change: L320P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031172
Gene: ENSMUSG00000029255
AA Change: L320P

DomainStartEndE-ValueType
Pfam:7tm_1 63 322 2.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094654
SMART Domains Protein: ENSMUSP00000092238
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 62 261 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113372
SMART Domains Protein: ENSMUSP00000108999
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 60 177 4.5e-20 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display prepubescent internal reproductive tracts with hypogonadism and hypogonadotrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Cluh C T 11: 74,662,076 A649V possibly damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Mark2 A G 19: 7,284,515 Y351H probably damaging Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tarbp1 A G 8: 126,447,047 I976T probably damaging Het
Tex14 T A 11: 87,499,605 V376D probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zc3hav1 C T 6: 38,332,757 V377I possibly damaging Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Gnrhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gnrhr APN 5 86197303 critical splice donor site probably null
IGL01432:Gnrhr APN 5 86182193 missense probably damaging 1.00
IGL02702:Gnrhr APN 5 86182269 missense possibly damaging 0.69
IGL03367:Gnrhr APN 5 86182331 missense probably benign 0.02
R0483:Gnrhr UTSW 5 86197575 missense probably damaging 1.00
R2199:Gnrhr UTSW 5 86197818 missense probably benign 0.26
R2303:Gnrhr UTSW 5 86197749 missense probably benign 0.01
R4400:Gnrhr UTSW 5 86182249 unclassified probably null
R5273:Gnrhr UTSW 5 86182246 missense possibly damaging 0.86
R5320:Gnrhr UTSW 5 86197614 missense possibly damaging 0.95
R6159:Gnrhr UTSW 5 86182357 missense probably damaging 1.00
R6221:Gnrhr UTSW 5 86185403 nonsense probably null
R6629:Gnrhr UTSW 5 86182309 missense probably benign 0.01
R6725:Gnrhr UTSW 5 86185313 missense probably damaging 0.97
X0018:Gnrhr UTSW 5 86197755 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGAGTAAGGACACATTTCGGG -3'
(R):5'- AACGCTAAAGATGACAGTCGC -3'

Sequencing Primer
(F):5'- GAAGGTCTTCTGAAGCTCTAACAAC -3'
(R):5'- GATGACAGTCGCATTCGCTAC -3'
Posted On2014-06-30