Mutagenetix > Incidental Mutation

Incidental Mutation 'R6599:Nqo2'

525145

Institutional Source

Beutler Lab

Gene Symbol

Nqo2

Ensembl Gene

ENSMUSG00000046949

Gene Name

N-ribosyldihydronicotinamide quinone reductase 2

Synonyms

Ox-2, Ox2, Nmor2, NRH: quinone oxidoreductase

MMRRC Submission

044723-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R6599 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34148670-34172426 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34163539 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 22 (F22S)

Ref Sequence

ENSEMBL: ENSMUSP00000152068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479] [ENSMUST00000171034]

AlphaFold

Q9JI75

Predicted Effect

probably damaging
Transcript: ENSMUST00000021843
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: F66S

Domain	Start	End	E-Value	Type
Pfam:FMN_red	4	159	5.6e-15	PFAM
Pfam:Flavodoxin_2	4	212	3.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000058978
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: F66S

Domain	Start	End	E-Value	Type
Pfam:FMN_red	4	158	2e-14	PFAM
Pfam:Flavodoxin_2	4	212	2.6e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000076532

SMART Domains

Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166354

SMART Domains

Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	66	3.8e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167237

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167597

Predicted Effect

probably benign
Transcript: ENSMUST00000168400

SMART Domains

Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	120	3.5e-31	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000220844
AA Change: F22S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222740
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223479
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000171034

SMART Domains

Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	228	3.54e-34	SMART

Meta Mutation Damage Score

0.7242

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 95.9%

Validation Efficiency

94% (32/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 137,882,250 (GRCm39)	H150R	probably benign	Het
Acbd5	C	T	2: 22,959,092 (GRCm39)		probably benign	Het
Adcyap1r1	G	A	6: 55,456,979 (GRCm39)	V237M	probably damaging	Het
Akr1c6	T	G	13: 4,499,318 (GRCm39)		probably null	Het
Ccdc7b	T	A	8: 129,893,462 (GRCm39)	F96L	probably benign	Het
Cubn	T	C	2: 13,315,484 (GRCm39)	H2983R	possibly damaging	Het
Dhx40	T	A	11: 86,695,175 (GRCm39)	I112L	possibly damaging	Het
Dnmbp	A	T	19: 43,845,025 (GRCm39)	D1070E	probably damaging	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Ep300	G	C	15: 81,470,914 (GRCm39)	D29H	unknown	Het
Exoc3	T	C	13: 74,337,277 (GRCm39)		probably null	Het
Fcsk	A	T	8: 111,619,915 (GRCm39)		probably null	Het
Gm6401	C	A	14: 41,788,821 (GRCm39)	E83*	probably null	Het
Gm8267	G	T	14: 44,955,367 (GRCm39)	T218K	possibly damaging	Het
H1f3	T	C	13: 23,739,451 (GRCm39)		probably null	Het
Hif3a	T	A	7: 16,776,530 (GRCm39)	D470V	possibly damaging	Het
Igf2r	T	C	17: 12,917,505 (GRCm39)	S1526G	possibly damaging	Het
Lrp2	T	C	2: 69,299,749 (GRCm39)	D3101G	probably damaging	Het
Megf6	A	G	4: 154,342,544 (GRCm39)		probably null	Het
Mthfs	G	A	9: 89,121,961 (GRCm39)	G149D	probably damaging	Het
Nnmt	T	C	9: 48,514,669 (GRCm39)	D116G	probably benign	Het
Or1e29	T	A	11: 73,667,506 (GRCm39)	M216L	probably benign	Het
Or7e175	T	C	9: 20,049,239 (GRCm39)	S276P	probably damaging	Het
Parm1	T	C	5: 91,741,718 (GRCm39)	S29P	possibly damaging	Het
Prokr2	C	T	2: 132,215,469 (GRCm39)	V331M	possibly damaging	Het
Ptch1	T	A	13: 63,670,918 (GRCm39)	I871F	probably damaging	Het
Rps6ka5	C	A	12: 100,564,168 (GRCm39)	G227V	probably damaging	Het
Tcaim	C	T	9: 122,663,844 (GRCm39)	Q445*	probably null	Het
Trappc14	G	T	5: 138,261,720 (GRCm39)		probably null	Het
Trpc7	T	C	13: 56,958,193 (GRCm39)		probably null	Het
Ubxn7	A	G	16: 32,203,743 (GRCm39)	E465G	probably damaging	Het
Unk	G	A	11: 115,938,628 (GRCm39)	R77Q	probably damaging	Het
Vmn1r226	A	T	17: 20,908,551 (GRCm39)	N261I	probably benign	Het
Vmn1r87	T	A	7: 12,865,886 (GRCm39)	K134*	probably null	Het
Vmn2r10	T	A	5: 109,143,944 (GRCm39)	I669L	probably benign	Het
Vmn2r115	A	G	17: 23,565,006 (GRCm39)	I298V	probably benign	Het
Yipf2	T	C	9: 21,501,144 (GRCm39)	K85E	probably damaging	Het
Zfp979	A	T	4: 147,698,083 (GRCm39)	C209S	probably benign	Het

Other mutations in Nqo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02135:Nqo2	APN	13	34,169,326 (GRCm39)	nonsense	probably null
IGL02884:Nqo2	APN	13	34,156,344 (GRCm39)	missense	probably damaging	1.00
R0021:Nqo2	UTSW	13	34,165,490 (GRCm39)	missense	probably benign
R0021:Nqo2	UTSW	13	34,165,490 (GRCm39)	missense	probably benign
R0848:Nqo2	UTSW	13	34,156,461 (GRCm39)	critical splice donor site	probably null
R0853:Nqo2	UTSW	13	34,163,560 (GRCm39)	missense	probably benign
R3417:Nqo2	UTSW	13	34,163,616 (GRCm39)	missense	probably benign	0.01
R4110:Nqo2	UTSW	13	34,163,620 (GRCm39)	missense	probably benign	0.00
R4936:Nqo2	UTSW	13	34,165,501 (GRCm39)	missense	probably damaging	1.00
R5861:Nqo2	UTSW	13	34,156,413 (GRCm39)	missense	probably damaging	1.00
R6161:Nqo2	UTSW	13	34,163,634 (GRCm39)	missense	probably damaging	0.99
R7909:Nqo2	UTSW	13	34,156,414 (GRCm39)	missense	probably damaging	1.00
R8133:Nqo2	UTSW	13	34,169,461 (GRCm39)	missense	probably benign	0.01
R8495:Nqo2	UTSW	13	34,165,477 (GRCm39)	missense	probably damaging	1.00
R8543:Nqo2	UTSW	13	34,169,297 (GRCm39)	critical splice acceptor site	probably null
R9211:Nqo2	UTSW	13	34,156,399 (GRCm39)	missense	probably benign	0.08
R9605:Nqo2	UTSW	13	34,156,361 (GRCm39)	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGGAAGCACTCTTACCAGTGTTC -3'
(R):5'- CAGTTCCAAAAGCAGTGTTCAAG -3'

Sequencing Primer
(F):5'- AGCCTTCTCTGTCAGCCTGATTG -3'
(R):5'- CAAGATCAGCTTCTTGCAC -3'

Posted On

2018-06-22