Incidental Mutation 'R6707:Dnm1'
ID528966
Institutional Source Beutler Lab
Gene Symbol Dnm1
Ensembl Gene ENSMUSG00000026825
Gene Namedynamin 1
Synonymsdynamin 1, Ftfl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6707 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32308471-32353338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32336241 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 312 (D312G)
Ref Sequence ENSEMBL: ENSMUSP00000143955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000091089] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000139238] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably null
Transcript: ENSMUST00000078352
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091089
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113350
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113352
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113365
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139238
SMART Domains Protein: ENSMUSP00000118855
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:Dynamin_N 34 57 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139624
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201433
AA Change: D312G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201494
AA Change: D312G

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202578
AA Change: D312G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825
AA Change: D312G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Meta Mutation Damage Score 0.646 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein is a GTPase which is required for membrane recycling, including vesicle endocytosis in neurons. It may also be involved in cellular fission via association with microtubules and actin filaments. Mutations in this gene have been shown to cause seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice display reduced postnatal viability. Null mutation of this gene results in abnormal synaptic vesicle morphology, and recycling during neuronal activity. Other alleles are associated with seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,223,122 V1943M probably benign Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Actg2 C T 6: 83,513,094 W341* probably null Het
Adam29 C T 8: 55,872,100 G440R probably damaging Het
AI314180 T A 4: 58,879,101 I63L possibly damaging Het
Arfgef3 T C 10: 18,621,155 D1153G probably benign Het
Arhgef28 G T 13: 97,936,716 Q1371K probably damaging Het
Arhgef28 T C 13: 98,075,116 T120A possibly damaging Het
BC051665 A T 13: 60,784,408 D122E probably benign Het
Boc A T 16: 44,500,616 I227N possibly damaging Het
Clca3b T A 3: 144,844,527 Q219L probably benign Het
Cyp2c66 T A 19: 39,186,500 F448Y probably damaging Het
Ddx5 A G 11: 106,782,232 M489T probably benign Het
Eqtn T C 4: 94,907,819 D215G probably benign Het
Evi5l A T 8: 4,206,322 T706S probably benign Het
Gtf2f1 T C 17: 57,007,770 E90G probably benign Het
Hpx A T 7: 105,595,475 S168T probably benign Het
Ipo4 C A 14: 55,628,904 V773L possibly damaging Het
Ireb2 C T 9: 54,903,961 T716I probably damaging Het
Klhl21 A G 4: 152,012,327 D350G possibly damaging Het
Myh13 A T 11: 67,350,260 N821I probably damaging Het
Nipbl G T 15: 8,324,559 T1698K probably benign Het
Nod2 A G 8: 88,665,189 H686R probably benign Het
Ntf3 A G 6: 126,164,728 probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Olfr816 T C 10: 129,911,739 T180A probably benign Het
Parp9 A T 16: 35,947,933 H161L probably damaging Het
Pkhd1l1 A G 15: 44,529,143 N1625D probably benign Het
Rdx T C 9: 52,063,654 F30S probably damaging Het
Smo T A 6: 29,736,174 V55E probably benign Het
Sox9 C A 11: 112,782,872 N96K probably damaging Het
Spp2 T G 1: 88,417,294 probably null Het
Tex46 A G 4: 136,612,850 N82S probably benign Het
Timm22 C T 11: 76,407,325 L41F possibly damaging Het
Tmem30a A T 9: 79,774,265 Y207* probably null Het
Tmem70 T C 1: 16,677,307 V216A probably damaging Het
Tspan18 T C 2: 93,209,957 N151S probably benign Het
Vmn2r90 T C 17: 17,728,102 C537R probably damaging Het
Vps50 A G 6: 3,545,583 Y339C probably damaging Het
Zp2 C T 7: 120,133,922 G599R possibly damaging Het
Other mutations in Dnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Dnm1 APN 2 32323450 missense probably benign 0.18
IGL02338:Dnm1 APN 2 32312771 missense probably damaging 1.00
IGL02555:Dnm1 APN 2 32328038 missense probably damaging 1.00
IGL02563:Dnm1 APN 2 32315919 splice site probably null
IGL03006:Dnm1 APN 2 32353121 missense possibly damaging 0.84
IGL03013:Dnm1 APN 2 32336284 missense probably benign 0.13
IGL03347:Dnm1 APN 2 32353187 missense probably benign 0.32
R0180:Dnm1 UTSW 2 32327993 missense probably damaging 0.99
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0387:Dnm1 UTSW 2 32320581 missense possibly damaging 0.90
R0608:Dnm1 UTSW 2 32335824 missense possibly damaging 0.89
R1230:Dnm1 UTSW 2 32315909 missense probably damaging 1.00
R1474:Dnm1 UTSW 2 32320584 missense probably benign 0.31
R1703:Dnm1 UTSW 2 32323451 missense probably benign 0.01
R1881:Dnm1 UTSW 2 32323730 missense probably damaging 1.00
R2155:Dnm1 UTSW 2 32314937 missense probably damaging 0.96
R4405:Dnm1 UTSW 2 32335972 missense probably damaging 1.00
R4592:Dnm1 UTSW 2 32336011 missense probably damaging 0.99
R5357:Dnm1 UTSW 2 32336241 missense probably null 0.17
R5926:Dnm1 UTSW 2 32315804 missense probably benign 0.00
R6135:Dnm1 UTSW 2 32333063 splice site probably null
R6463:Dnm1 UTSW 2 32309591 utr 3 prime probably benign
R6563:Dnm1 UTSW 2 32312726 missense probably damaging 1.00
R6626:Dnm1 UTSW 2 32340880 missense probably damaging 1.00
R6790:Dnm1 UTSW 2 32333067 missense probably damaging 1.00
R6803:Dnm1 UTSW 2 32312754 missense probably damaging 1.00
R7156:Dnm1 UTSW 2 32340467 missense probably damaging 1.00
R7313:Dnm1 UTSW 2 32336009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAACTGCTGGACCATC -3'
(R):5'- AAAGCTCATCTCTGGGAGCG -3'

Sequencing Primer
(F):5'- AAACTGCTGGACCATCCTGTG -3'
(R):5'- CAGGGGTTGCATGTCAAATATCCC -3'
Posted On2018-07-24