Incidental Mutation 'R6781:Pik3cb'
ID531424
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99040992 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 996 (T996A)
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
PDB Structure
CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035037
AA Change: T996A

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: T996A

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2513:Pik3cb UTSW 9 99061842 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4009:Pik3cb UTSW 9 99040929 missense probably damaging 0.98
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4249:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 99094598 missense probably benign 0.01
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6869:Pik3cb UTSW 9 99060259 missense probably benign 0.08
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATCTTGAGCAGGGAGTTG -3'
(R):5'- CATACATTAGCTGAAGTACACATGC -3'

Sequencing Primer
(F):5'- AACTCAGAGCTTCAGTCTTGGCAG -3'
(R):5'- TTAGCTGAAGTACACATGCCCTCG -3'
Posted On2018-08-29