Incidental Mutation 'R6793:Gabrr1'
ID532683
Institutional Source Beutler Lab
Gene Symbol Gabrr1
Ensembl Gene ENSMUSG00000028280
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 1
SynonymsGABA-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6793 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location33132521-33163588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33162712 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 426 (V426G)
Ref Sequence ENSEMBL: ENSMUSP00000029947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029947
AA Change: V426G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029947
Gene: ENSMUSG00000028280
AA Change: V426G

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 69 276 4.8e-53 PFAM
Pfam:Neur_chan_memb 283 402 3.1e-33 PFAM
transmembrane domain 453 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display altered visual processing in the retina. Mice homozygous for a different knock-out allele exhibit alterations of mechanical pain sensitivity, GABA-inhibited spinal cord responses, and olfactory function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A C 14: 32,806,821 I48L probably benign Het
2010315B03Rik A T 9: 124,295,422 N19K possibly damaging Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Abraxas2 T C 7: 132,874,834 I98T probably damaging Het
Ankrd17 G A 5: 90,265,512 T1181I probably damaging Het
Bsn T A 9: 108,114,615 K1313* probably null Het
C130060K24Rik C T 6: 65,381,421 A43V probably benign Het
Chst4 A T 8: 110,030,067 V388D probably damaging Het
Ckap5 T G 2: 91,568,709 W613G probably damaging Het
Clock GACTCACT GACT 5: 76,237,120 probably null Het
Enpp1 T C 10: 24,655,825 D520G probably damaging Het
Epha3 T C 16: 63,773,455 N90S probably benign Het
Esp36 A T 17: 38,417,114 M92K unknown Het
Fam135a A G 1: 24,067,925 V44A possibly damaging Het
Fndc8 T C 11: 82,897,586 S81P probably damaging Het
Fsip2 T G 2: 82,989,494 N5190K probably benign Het
Igkv6-15 T A 6: 70,406,992 M1L probably benign Het
Lrrc36 A G 8: 105,458,433 E614G probably damaging Het
Man1a2 A T 3: 100,632,597 I176K possibly damaging Het
Mapk4 T A 18: 73,930,468 N561I probably damaging Het
Med15 A T 16: 17,652,703 probably benign Het
Mfsd2a A G 4: 122,950,705 V258A probably benign Het
Micu3 G A 8: 40,380,695 V457I probably damaging Het
Mov10l1 T A 15: 88,996,184 V291E possibly damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ncbp1 T C 4: 46,157,827 I355T probably damaging Het
Olfr571 A G 7: 102,909,728 V37A probably benign Het
Olfr600 T C 7: 103,346,266 T221A probably benign Het
Otub2 A G 12: 103,389,019 probably benign Het
Pcdh15 T C 10: 74,631,139 S1666P probably damaging Het
Pcdha12 T A 18: 37,022,181 V651E probably damaging Het
Pomt1 T C 2: 32,242,949 F186L probably damaging Het
Prl3d3 G A 13: 27,161,061 A140T probably benign Het
Ptprn G A 1: 75,258,142 T267I probably benign Het
Rhbdd2 T A 5: 135,636,154 I113N probably damaging Het
Saraf T A 8: 34,168,613 probably null Het
Slc41a2 T C 10: 83,301,158 probably null Het
Slc47a1 A G 11: 61,359,403 V352A probably benign Het
Tmem237 T C 1: 59,114,216 T49A probably benign Het
Tmprss11e C T 5: 86,715,555 C217Y probably damaging Het
Ubfd1 T C 7: 122,067,880 V140A probably benign Het
Utrn A G 10: 12,640,925 probably null Het
Utrn T A 10: 12,699,100 I1028F possibly damaging Het
Virma C T 4: 11,539,968 T1479M probably damaging Het
Vwa7 G T 17: 35,024,891 R767L probably benign Het
Wdfy3 A T 5: 101,917,431 Y1290* probably null Het
Zfp970 G A 2: 177,475,545 C304Y probably damaging Het
Other mutations in Gabrr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Gabrr1 APN 4 33162634 missense probably benign
IGL02052:Gabrr1 APN 4 33152567 missense probably damaging 0.98
IGL02169:Gabrr1 APN 4 33160261 missense probably damaging 1.00
IGL02834:Gabrr1 APN 4 33151426 missense probably damaging 1.00
PIT4498001:Gabrr1 UTSW 4 33160225 missense probably damaging 1.00
R0135:Gabrr1 UTSW 4 33160224 missense probably damaging 1.00
R0606:Gabrr1 UTSW 4 33132696 missense probably benign 0.30
R0739:Gabrr1 UTSW 4 33162781 missense probably benign 0.08
R0843:Gabrr1 UTSW 4 33161717 missense possibly damaging 0.93
R1182:Gabrr1 UTSW 4 33132680 missense probably benign
R1628:Gabrr1 UTSW 4 33152432 missense probably damaging 1.00
R1724:Gabrr1 UTSW 4 33161651 missense probably damaging 0.98
R2300:Gabrr1 UTSW 4 33152449 missense probably benign 0.01
R2405:Gabrr1 UTSW 4 33157110 missense probably damaging 1.00
R3424:Gabrr1 UTSW 4 33158058 missense probably damaging 1.00
R3500:Gabrr1 UTSW 4 33158184 splice site probably benign
R4575:Gabrr1 UTSW 4 33158175 missense possibly damaging 0.94
R4923:Gabrr1 UTSW 4 33162820 missense possibly damaging 0.59
R5686:Gabrr1 UTSW 4 33161684 missense probably damaging 0.98
R5941:Gabrr1 UTSW 4 33162676 missense probably benign 0.01
R6122:Gabrr1 UTSW 4 33161695 missense probably damaging 1.00
R6217:Gabrr1 UTSW 4 33149026 splice site probably null
R6232:Gabrr1 UTSW 4 33161632 missense probably benign 0.41
R6489:Gabrr1 UTSW 4 33162855 missense probably benign 0.02
R6996:Gabrr1 UTSW 4 33158157 missense probably damaging 0.96
R7396:Gabrr1 UTSW 4 33160207 missense probably damaging 1.00
R7465:Gabrr1 UTSW 4 33146970 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTACACCCTTCATGCCC -3'
(R):5'- TAGGACATGCTGAGACATACAC -3'

Sequencing Primer
(F):5'- CCTTCTGCAGGCTTTGGAGC -3'
(R):5'- TGCTGAGACATACACAATTACAGG -3'
Posted On2018-08-29