Incidental Mutation 'R6847:Ifit3b'
ID534835
Institutional Source Beutler Lab
Gene Symbol Ifit3b
Ensembl Gene ENSMUSG00000062488
Gene Nameinterferon-induced protein with tetratricopeptide repeats 3B
SynonymsI830012O16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34607970-34613401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34611525 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 34 (M34L)
Ref Sequence ENSEMBL: ENSMUSP00000075599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076249]
Predicted Effect probably benign
Transcript: ENSMUST00000076249
AA Change: M34L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075599
Gene: ENSMUSG00000062488
AA Change: M34L

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 5e-6 BLAST
TPR 241 274 1.02e1 SMART
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Ifit3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
galilee UTSW 19 34611525 missense probably benign
negev UTSW 19 34611460 missense probably benign 0.14
R1528:Ifit3b UTSW 19 34611672 missense probably benign 0.05
R1996:Ifit3b UTSW 19 34611477 missense probably damaging 1.00
R2680:Ifit3b UTSW 19 34612305 missense probably benign 0.01
R2971:Ifit3b UTSW 19 34612017 nonsense probably null
R4395:Ifit3b UTSW 19 34612551 nonsense probably null
R4719:Ifit3b UTSW 19 34612630 missense probably damaging 0.96
R4726:Ifit3b UTSW 19 34611460 missense probably benign 0.14
R5094:Ifit3b UTSW 19 34612548 missense possibly damaging 0.93
R5958:Ifit3b UTSW 19 34611742 missense probably benign 0.02
R5987:Ifit3b UTSW 19 34612198 missense probably damaging 1.00
R6381:Ifit3b UTSW 19 34612471 missense probably benign 0.00
R6614:Ifit3b UTSW 19 34611519 missense probably benign 0.01
R6662:Ifit3b UTSW 19 34611937 missense probably damaging 1.00
R6804:Ifit3b UTSW 19 34611547 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTCCATCCAGTTACCATGC -3'
(R):5'- AGTAGATCCAGGCGTAGTTTCC -3'

Sequencing Primer
(F):5'- CCAGTTACCATGCAAAATTAAACATC -3'
(R):5'- TGACCAGTCGGCGAATTTC -3'
Posted On2018-09-12