Incidental Mutation 'R7017:Scamp1'
ID545400
Institutional Source Beutler Lab
Gene Symbol Scamp1
Ensembl Gene ENSMUSG00000021687
Gene Namesecretory carrier membrane protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location94201310-94285857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94224915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 152 (R152S)
Ref Sequence ENSEMBL: ENSMUSP00000120053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022197] [ENSMUST00000138255] [ENSMUST00000152555] [ENSMUST00000153558]
Predicted Effect probably damaging
Transcript: ENSMUST00000022197
AA Change: R204S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022197
Gene: ENSMUSG00000021687
AA Change: R204S

DomainStartEndE-ValueType
coiled coil region 75 114 N/A INTRINSIC
Pfam:SCAMP 117 292 7.4e-74 PFAM
low complexity region 314 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138255
SMART Domains Protein: ENSMUSP00000121039
Gene: ENSMUSG00000021687

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 116 2.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152555
AA Change: R152S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123135
Gene: ENSMUSG00000021687
AA Change: R152S

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153558
AA Change: R152S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120053
Gene: ENSMUSG00000021687
AA Change: R152S

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities, but final cell capacitance of mast cells completing exocytosis was smaller than controls and an increased proportion of reversible fusion events was noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Scamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Scamp1 APN 13 94204022 missense probably damaging 1.00
IGL02269:Scamp1 APN 13 94232186 splice site probably benign
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0254:Scamp1 UTSW 13 94210580 missense probably benign 0.00
R0367:Scamp1 UTSW 13 94210580 missense probably benign 0.01
R0559:Scamp1 UTSW 13 94208182 missense possibly damaging 0.79
R1147:Scamp1 UTSW 13 94224886 unclassified probably null
R1400:Scamp1 UTSW 13 94224947 missense possibly damaging 0.53
R1499:Scamp1 UTSW 13 94224929 missense probably benign 0.03
R5206:Scamp1 UTSW 13 94232107 missense probably damaging 1.00
R5259:Scamp1 UTSW 13 94232086 missense probably benign
R5300:Scamp1 UTSW 13 94204162 missense probably damaging 0.99
R6128:Scamp1 UTSW 13 94208227 missense possibly damaging 0.80
R7219:Scamp1 UTSW 13 94224907 missense probably damaging 1.00
R7242:Scamp1 UTSW 13 94233140 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATACGCCAACTTTCCCTTTGAGG -3'
(R):5'- TGCAAACATTCTGTCTGTCTTACG -3'

Sequencing Primer
(F):5'- TCCCTTTGAGGTACATACAATACAG -3'
(R):5'- GATCCCACAGTCCATGCAGTG -3'
Posted On2019-05-13