Incidental Mutation 'R7017:Vmn2r111'
ID545414
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7017 (G1)
Quality Score221.999
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22559051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- TACAGGATGCTATCAGGTTTTCTTC -3'

Sequencing Primer
(F):5'- GAGTAACTTAGGACAGAGATGt -3'
(R):5'- TTCAAGGAGTTGGGAAACAATTC -3'
Posted On2019-05-13