Incidental Mutation 'R7078:Sec23a'
ID549367
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58992283 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 277 (C277R)
Ref Sequence ENSEMBL: ENSMUSP00000021375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect probably benign
Transcript: ENSMUST00000021375
AA Change: C277R

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: C277R

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165134
AA Change: C248R

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: C248R

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Dcc T A 18: 71,547,398 K589I probably benign Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dtnb A G 12: 3,748,480 Q438R possibly damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Plaa T G 4: 94,574,051 T530P probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Prrc2b A T 2: 32,213,519 D1003V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsg1 A T 4: 141,219,848 Y180F probably benign Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Wdr90 C T 17: 25,849,649 V1285M probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGACGTTACACAAACAGAAAACTC -3'
(R):5'- TCCAAATAAATGTCTTCCTTTTAGCA -3'

Sequencing Primer
(F):5'- GTTACACAAACAGAAAACTCACAAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2019-05-15