Incidental Mutation 'R7092:Dcaf12'
ID550267
Institutional Source Beutler Lab
Gene Symbol Dcaf12
Ensembl Gene ENSMUSG00000028436
Gene NameDDB1 and CUL4 associated factor 12
Synonyms1500001L20Rik, Wdr40a, 5830424K06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026893; MGI: 1916220  

Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7092 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41291300-41314889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41301366 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 190 (I190N)
Ref Sequence ENSEMBL: ENSMUSP00000030145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030145]
Predicted Effect probably damaging
Transcript: ENSMUST00000030145
AA Change: I190N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030145
Gene: ENSMUSG00000028436
AA Change: I190N

DomainStartEndE-ValueType
WD40 77 116 1.53e2 SMART
Blast:WD40 121 169 5e-20 BLAST
WD40 172 211 3.75e-4 SMART
WD40 236 280 4.44e0 SMART
Blast:WD40 284 323 7e-7 BLAST
WD40 328 366 2.37e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
Atad5 T A 11: 80,120,720 N1307K possibly damaging Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mfsd4a G T 1: 132,067,663 T77N probably benign Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pde4b G A 4: 102,601,851 V523M probably damaging Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Ppme1 A T 7: 100,371,822 M1K probably null Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Rnf123 C A 9: 108,068,600 R329L probably benign Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slc12a4 G T 8: 105,945,223 A922D probably damaging Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Dcaf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Dcaf12 APN 4 41298299 missense probably benign
IGL02252:Dcaf12 APN 4 41294085 missense probably benign 0.17
IGL02508:Dcaf12 APN 4 41296310 critical splice donor site probably null
R0066:Dcaf12 UTSW 4 41298338 missense probably damaging 0.98
R0066:Dcaf12 UTSW 4 41298338 missense probably damaging 0.98
R0382:Dcaf12 UTSW 4 41302672 missense probably damaging 1.00
R2001:Dcaf12 UTSW 4 41302804 missense probably damaging 1.00
R2095:Dcaf12 UTSW 4 41294085 missense probably benign 0.17
R5109:Dcaf12 UTSW 4 41298329 missense possibly damaging 0.89
R5434:Dcaf12 UTSW 4 41302744 missense probably benign 0.00
R5755:Dcaf12 UTSW 4 41313356 missense probably damaging 0.99
R6016:Dcaf12 UTSW 4 41313267 missense probably damaging 1.00
R6160:Dcaf12 UTSW 4 41294043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCGGACCACCTAGCTAATG -3'
(R):5'- GAGGCCCACGTTGTTCTTTG -3'

Sequencing Primer
(F):5'- GGACCACCTAGCTAATGAGTAAATTC -3'
(R):5'- TCAGCACCAGGGTCTCCATATG -3'
Posted On2019-05-15