Incidental Mutation 'PIT4378001:Unc5a'
ID555019
Institutional Source Beutler Lab
Gene Symbol Unc5a
Ensembl Gene ENSMUSG00000025876
Gene Nameunc-5 netrin receptor A
SynonymsUnc5h1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4378001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54949411-55006018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54995868 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 122 (Y122H)
Ref Sequence ENSEMBL: ENSMUSP00000026994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000109994] [ENSMUST00000136852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026994
AA Change: Y122H

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: Y122H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109994
AA Change: Y122H

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: Y122H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136852
SMART Domains Protein: ENSMUSP00000116585
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
TSP1 20 70 1.23e-1 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,015,207 L14P probably damaging Het
2310033P09Rik T C 11: 59,208,976 V100A probably benign Het
9530053A07Rik G A 7: 28,154,464 D1618N possibly damaging Het
Adamtsl1 T C 4: 86,199,364 V188A possibly damaging Het
Aldh6a1 T C 12: 84,441,872 D80G probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Arrdc1 T A 2: 24,926,633 Y177F probably damaging Het
Asap1 C T 15: 64,135,848 R384Q probably damaging Het
Atxn2l A T 7: 126,497,271 V433D probably benign Het
Bbs1 G A 19: 4,891,675 A529V probably benign Het
Bbx G A 16: 50,280,473 R20* probably null Het
Bend5 T C 4: 111,431,107 V106A probably benign Het
C1galt1 A G 6: 7,863,944 N8S probably benign Het
Cdc42ep1 G A 15: 78,849,680 D327N possibly damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Csmd1 T C 8: 15,895,728 T3562A probably damaging Het
Dnah7a A G 1: 53,531,203 S1815P probably damaging Het
Ei24 A T 9: 36,786,024 L136Q probably damaging Het
Extl2 T G 3: 116,010,690 M1R probably null Het
Fam160a1 A G 3: 85,730,551 L147P probably damaging Het
Fat3 T C 9: 16,376,808 E473G probably benign Het
Fgfr1op T C 17: 8,182,273 S209P probably damaging Het
G6pc3 T A 11: 102,190,001 W26R probably damaging Het
Hc T A 2: 35,031,864 Y610F probably benign Het
Hecw1 T C 13: 14,377,783 D77G probably damaging Het
Hgf T C 5: 16,611,862 V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hyou1 A C 9: 44,390,851 D968A probably benign Het
Jmjd1c T A 10: 67,229,913 S1525T probably damaging Het
Kcnc4 G A 3: 107,447,563 T523I probably benign Het
Kcng1 C T 2: 168,262,684 C414Y probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Krt18 A T 15: 102,029,923 T194S probably benign Het
Krt76 A C 15: 101,892,407 N151K probably damaging Het
Krtap31-2 A G 11: 99,936,716 T125A possibly damaging Het
Lama5 A G 2: 180,189,445 V1807A possibly damaging Het
Lats1 T G 10: 7,705,605 V718G probably damaging Het
Mef2b A G 8: 70,164,260 K4E probably damaging Het
Mertk T C 2: 128,782,617 probably null Het
Mroh8 A G 2: 157,228,700 V577A possibly damaging Het
Mtcl1 T G 17: 66,438,279 N381T probably damaging Het
Nfyc T A 4: 120,790,491 probably null Het
Nol4 C A 18: 23,039,876 W56L probably damaging Het
Notch2 A T 3: 98,142,956 D1849V probably damaging Het
Olfr1406 T C 1: 173,183,814 T207A probably benign Het
Olfr1436 A G 19: 12,298,712 M140T probably damaging Het
Olfr284 A G 15: 98,340,272 V239A possibly damaging Het
Olfr287 G A 15: 98,207,571 T271I probably damaging Het
Olfr297 A T 7: 86,527,098 T114S possibly damaging Het
Olfr733 T C 14: 50,298,898 N137S probably benign Het
Olfr846 T A 9: 19,361,175 Y60F probably damaging Het
Oxr1 G A 15: 41,801,582 V138I probably benign Het
Pars2 A G 4: 106,654,293 E424G possibly damaging Het
Peli2 C A 14: 48,168,269 Y50* probably null Het
Plag1 T A 4: 3,905,492 H66L probably benign Het
Psme4 T C 11: 30,821,079 probably benign Het
Robo1 A T 16: 73,004,535 S1016C probably damaging Het
Rrbp1 A G 2: 143,974,540 V723A probably benign Het
Sgip1 C A 4: 102,921,083 D292E unknown Het
Skint4 T A 4: 112,087,035 C23S probably benign Het
Slc22a28 A C 19: 8,071,914 S323R probably damaging Het
Slc41a3 A G 6: 90,640,909 T306A probably benign Het
Spata13 A G 14: 60,749,996 M868V probably damaging Het
Spata6 T G 4: 111,746,181 I31S possibly damaging Het
Sycp3 A T 10: 88,466,504 K119* probably null Het
Tlk2 T A 11: 105,281,220 S739T unknown Het
Trim10 T C 17: 36,877,128 V412A probably damaging Het
Ttc3 T A 16: 94,410,906 F377I probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Uncx C T 5: 139,544,622 R152* probably null Het
Usp44 A G 10: 93,845,655 probably benign Het
Vamp2 A C 11: 69,089,738 D44A probably benign Het
Vmn2r83 A G 10: 79,469,015 T20A probably benign Het
Vmn2r84 A T 10: 130,385,915 I812N probably damaging Het
Vrtn T G 12: 84,649,169 L231R probably damaging Het
Wdr75 A G 1: 45,820,173 T677A probably damaging Het
Xylt1 C A 7: 117,548,865 S221R possibly damaging Het
Zscan22 A G 7: 12,904,056 E125G possibly damaging Het
Zxdc A T 6: 90,373,716 H383L probably damaging Het
Other mutations in Unc5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Unc5a APN 13 54995820 missense probably benign 0.00
IGL00339:Unc5a APN 13 54995815 missense possibly damaging 0.89
IGL00924:Unc5a APN 13 55004514 missense probably damaging 0.99
IGL01411:Unc5a APN 13 55002928 missense probably damaging 1.00
IGL01511:Unc5a APN 13 55004816 missense probably damaging 0.97
IGL02430:Unc5a APN 13 55002482 missense probably damaging 1.00
IGL02996:Unc5a APN 13 54996178 missense probably damaging 0.99
IGL03188:Unc5a APN 13 54999503 missense probably damaging 0.98
PIT1430001:Unc5a UTSW 13 55003896 missense probably damaging 1.00
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0028:Unc5a UTSW 13 55003913 missense possibly damaging 0.70
R0505:Unc5a UTSW 13 55004954 missense probably damaging 1.00
R0744:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R0745:Unc5a UTSW 13 55005255 frame shift probably null
R0836:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R1018:Unc5a UTSW 13 54990952 missense possibly damaging 0.81
R1432:Unc5a UTSW 13 55004472 unclassified probably benign
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1691:Unc5a UTSW 13 55002924 missense probably damaging 1.00
R2132:Unc5a UTSW 13 54991083 missense probably damaging 0.96
R4020:Unc5a UTSW 13 55003369 missense probably damaging 1.00
R4080:Unc5a UTSW 13 55004481 missense possibly damaging 0.62
R4720:Unc5a UTSW 13 55003883 missense probably null 1.00
R4876:Unc5a UTSW 13 54997229 missense probably benign
R4953:Unc5a UTSW 13 54999870 missense probably benign 0.02
R5112:Unc5a UTSW 13 55003418 critical splice donor site probably null
R5593:Unc5a UTSW 13 55004934 missense possibly damaging 0.91
R5903:Unc5a UTSW 13 54999690 missense possibly damaging 0.92
R6521:Unc5a UTSW 13 55004935 missense probably benign 0.01
R6723:Unc5a UTSW 13 54995889 missense probably benign 0.23
R7038:Unc5a UTSW 13 55004484 missense probably damaging 1.00
R7065:Unc5a UTSW 13 54991083 missense probably damaging 1.00
R7241:Unc5a UTSW 13 54991020 missense probably damaging 1.00
R7365:Unc5a UTSW 13 54996573 missense possibly damaging 0.80
R7487:Unc5a UTSW 13 54996549 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GATAAACCAGCAGCATCCCTGG -3'
(R):5'- ACCATGTGCATTGAGGAGTGTG -3'

Sequencing Primer
(F):5'- AGCAGCATCCCTGGAGTTC -3'
(R):5'- GATTTATGTTCCTAGGCACTGC -3'
Posted On2019-06-07