Incidental Mutation 'PIT4151001:Ak6'
ID557041
Institutional Source Beutler Lab
Gene Symbol Ak6
Ensembl Gene ENSMUSG00000078941
Gene Nameadenylate kinase 6
Synonyms2810046E22Rik, 4921516M08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location100650979-100666359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100655095 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 15 (D15E)
Ref Sequence ENSEMBL: ENSMUSP00000081772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022135] [ENSMUST00000022136] [ENSMUST00000084721] [ENSMUST00000167256] [ENSMUST00000177848] [ENSMUST00000185767] [ENSMUST00000187792] [ENSMUST00000190165] [ENSMUST00000190594] [ENSMUST00000190729] [ENSMUST00000226050]
Predicted Effect probably benign
Transcript: ENSMUST00000022135
SMART Domains Protein: ENSMUSP00000022135
Gene: ENSMUSG00000078941

DomainStartEndE-ValueType
Pfam:AAA_17 5 113 1.1e-13 PFAM
Pfam:AAA 6 45 3.6e-6 PFAM
Pfam:AAA_18 6 126 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084721
AA Change: D15E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081772
Gene: ENSMUSG00000078941
AA Change: D15E

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167256
AA Change: D15E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132143
Gene: ENSMUSG00000052293
AA Change: D15E

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 9 129 1.4e-52 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177848
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185767
AA Change: D15E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140423
Gene: ENSMUSG00000052293
AA Change: D15E

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 2.2e-62 PFAM
Pfam:Bromo_TP 12 77 7.6e-5 PFAM
Pfam:CENP-S 15 80 5.7e-7 PFAM
Pfam:Histone 16 78 1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187792
AA Change: D15E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140051
Gene: ENSMUSG00000052293
AA Change: D15E

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3e-62 PFAM
Pfam:CENP-S 15 80 6.9e-7 PFAM
Pfam:Histone 16 78 1.3e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190165
AA Change: D15E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139407
Gene: ENSMUSG00000052293
AA Change: D15E

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3.8e-62 PFAM
Pfam:CENP-S 15 80 7.9e-7 PFAM
Pfam:Histone 16 78 1.4e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190594
AA Change: D15E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140244
Gene: ENSMUSG00000052293
AA Change: D15E

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190729
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Ak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ak6 APN 13 100664091 missense probably benign 0.05
R0189:Ak6 UTSW 13 100655142 missense probably damaging 1.00
R1716:Ak6 UTSW 13 100655669 missense probably benign
R1736:Ak6 UTSW 13 100655181 unclassified probably null
R4351:Ak6 UTSW 13 100655603 nonsense probably null
R4625:Ak6 UTSW 13 100655673 missense probably benign 0.00
R5690:Ak6 UTSW 13 100655621 unclassified probably null
R5711:Ak6 UTSW 13 100654214 missense probably damaging 0.97
R5870:Ak6 UTSW 13 100655424 missense probably damaging 1.00
R6018:Ak6 UTSW 13 100665951 nonsense probably null
R6386:Ak6 UTSW 13 100655803 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGCCCAGACTCATTGC -3'
(R):5'- CGTACGTCATCTGCATCAAC -3'

Sequencing Primer
(F):5'- GCCCAGACTCATTGCATATAAAGTG -3'
(R):5'- GTACGTCATCTGCATCAACAGTAG -3'
Posted On2019-06-07