Incidental Mutation 'PIT4151001:Sorl1'
ID557035
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41968622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 2210 (V2210D)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: V2210D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V2210D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTTCAGTTCACAGTTGATAC -3'
(R):5'- TTAGTGCGGTCACCTAGGGATG -3'

Sequencing Primer
(F):5'- TCAGTTCACAGTTGATACTACAAAG -3'
(R):5'- GGTAACCAGTAACTTGAACATGGC -3'
Posted On2019-06-07