Incidental Mutation 'R7158:Inhbb'
ID557414
Institutional Source Beutler Lab
Gene Symbol Inhbb
Ensembl Gene ENSMUSG00000037035
Gene Nameinhibin beta-B
Synonymsactivin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R7158 (G1)
Quality Score137.008
Status Validated
Chromosome1
Chromosomal Location119415465-119422248 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119421022 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 22 (L22*)
Ref Sequence ENSEMBL: ENSMUSP00000044918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038765]
Predicted Effect probably null
Transcript: ENSMUST00000038765
AA Change: L22*
SMART Domains Protein: ENSMUSP00000044918
Gene: ENSMUSG00000037035
AA Change: L22*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TGFb_propeptide 66 282 1.4e-13 PFAM
TGFB 307 411 5.55e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. Homozygous knockout mice for this gene exhibit eyelid defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Some homozygotes for targeted null mutations exhibit open eyes at birth and impaired maternal nuturing. Mutant females for one line exhibit extended gestation length, retarded mammary duct elongation and alveolar morphogenesis, and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Inhbb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Inhbb APN 1 119417983 missense probably benign 0.33
R0091:Inhbb UTSW 1 119417395 missense probably damaging 1.00
R0609:Inhbb UTSW 1 119417416 missense probably damaging 1.00
R1352:Inhbb UTSW 1 119420695 missense probably benign 0.30
R2119:Inhbb UTSW 1 119420701 missense probably benign 0.04
R3964:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R3966:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R4996:Inhbb UTSW 1 119420818 missense probably damaging 1.00
R5709:Inhbb UTSW 1 119417530 missense probably damaging 0.97
R5973:Inhbb UTSW 1 119418076 missense possibly damaging 0.70
R6376:Inhbb UTSW 1 119417681 missense probably damaging 1.00
R6499:Inhbb UTSW 1 119417339 missense probably damaging 1.00
R6685:Inhbb UTSW 1 119417605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTGTCTCTTCACCGCC -3'
(R):5'- TTCAGTCTCCAGAGCGACTTG -3'

Sequencing Primer
(F):5'- TCTTCACCGCCTCCAGGAAG -3'
(R):5'- TCGCTTCACCCCGATCAGG -3'
Posted On2019-06-26