Incidental Mutation 'R7158:Prrg4'
ID557418
Institutional Source Beutler Lab
Gene Symbol Prrg4
Ensembl Gene ENSMUSG00000027171
Gene Nameproline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
Synonyms9930111I18Rik, TMG4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location104830741-104849876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104832613 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 216 (V216E)
Ref Sequence ENSEMBL: ENSMUSP00000028593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028593]
Predicted Effect probably damaging
Transcript: ENSMUST00000028593
AA Change: V216E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028593
Gene: ENSMUSG00000027171
AA Change: V216E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GLA 33 97 1.71e-18 SMART
transmembrane domain 118 140 N/A INTRINSIC
low complexity region 203 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Prrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Prrg4 APN 2 104832690 missense probably damaging 1.00
R0884:Prrg4 UTSW 2 104839362 missense probably damaging 1.00
R1624:Prrg4 UTSW 2 104832682 missense probably damaging 0.97
R1647:Prrg4 UTSW 2 104832743 missense probably benign 0.00
R1648:Prrg4 UTSW 2 104832743 missense probably benign 0.00
R2151:Prrg4 UTSW 2 104839388 missense probably damaging 1.00
R5592:Prrg4 UTSW 2 104832778 missense probably benign 0.22
R5898:Prrg4 UTSW 2 104845033 missense probably benign 0.00
R7203:Prrg4 UTSW 2 104839442 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAGAGCTGTGGTGAATTCTC -3'
(R):5'- TGCACCTCTGTTAAACCTAAATGC -3'

Sequencing Primer
(F):5'- GGTGAATTCTCTTCTGTATGCATC -3'
(R):5'- GTTAAACCTAAATGCCATCTCTCTG -3'
Posted On2019-06-26