Incidental Mutation 'R7249:D630045J12Rik'
ID563751
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7249 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38136950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1769 (V1769D)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117556
AA Change: V1628D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: V1628D

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169256
AA Change: V1769D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: V1769D

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,341 T38A probably benign Het
3425401B19Rik G T 14: 32,663,314 S231R possibly damaging Het
Abi1 T C 2: 22,957,089 E250G possibly damaging Het
Actl6b T A 5: 137,555,085 S120T probably damaging Het
Adgrv1 G A 13: 81,374,259 H5920Y probably damaging Het
Adra2c G A 5: 35,280,955 R357H probably damaging Het
Ap3d1 T C 10: 80,741,933 D20G probably damaging Het
Arfgef3 A T 10: 18,630,835 D847E possibly damaging Het
Cacna1d T C 14: 30,142,703 E434G probably damaging Het
Carm1 T C 9: 21,586,209 Y356H probably benign Het
Clip1 T C 5: 123,603,600 K1075R probably damaging Het
Cyp27b1 G T 10: 127,051,049 probably null Het
Dchs2 C T 3: 83,128,029 Q28* probably null Het
Dpp4 A G 2: 62,385,203 F107L probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Faap24 A G 7: 35,395,060 V105A probably benign Het
Gabra6 A T 11: 42,317,432 D166E probably damaging Het
Gfpt1 A G 6: 87,056,144 E117G probably damaging Het
H2-T10 T C 17: 36,119,377 D224G probably damaging Het
Hspa12a T A 19: 58,805,433 E332V probably benign Het
Htr5b T A 1: 121,510,474 N343Y probably damaging Het
Irf8 C A 8: 120,739,832 N5K possibly damaging Het
Itgb1 C A 8: 128,720,404 Q467K probably benign Het
Itpr2 C A 6: 146,311,052 C1522F probably damaging Het
Jmjd1c T A 10: 67,189,817 L138I probably benign Het
Lrrc8b G T 5: 105,481,267 R493L probably benign Het
Malrd1 G T 2: 15,623,340 C400F probably damaging Het
March8 G A 6: 116,406,234 E257K probably benign Het
Mastl G A 2: 23,146,139 H122Y probably damaging Het
Mis18a T C 16: 90,726,314 K98R possibly damaging Het
Msra A G 14: 64,440,763 V28A probably benign Het
Mtmr7 A G 8: 40,590,477 V177A probably benign Het
Nelfcd T C 2: 174,423,206 probably null Het
Nemp1 T C 10: 127,693,526 S226P probably damaging Het
Nmnat1 G A 4: 149,469,642 T147I probably null Het
Ntng2 A G 2: 29,227,992 V148A probably benign Het
Nup214 A G 2: 31,988,233 H304R possibly damaging Het
Olfr1239 T C 2: 89,417,873 Y180C probably damaging Het
Phldb2 C A 16: 45,801,614 A623S probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkn3 G A 2: 30,084,761 R429Q probably benign Het
Plcb4 A G 2: 136,007,821 probably null Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnp G A 14: 50,951,430 V227I probably benign Het
Pskh1 T C 8: 105,913,254 S189P possibly damaging Het
Rbpms2 T G 9: 65,649,350 V24G probably damaging Het
Robo3 T A 9: 37,424,833 I446L probably benign Het
Sept8 A T 11: 53,535,122 K174I probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slco4a1 A G 2: 180,464,811 Y262C probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spidr T C 16: 15,966,648 S519G probably benign Het
Ssx2ip A G 3: 146,426,438 N218S possibly damaging Het
Svil T C 18: 5,056,270 V381A probably benign Het
Svil T C 18: 5,062,247 S769P probably damaging Het
Tep1 A T 14: 50,824,275 C2595S possibly damaging Het
Tiam1 T C 16: 89,843,255 Y858C probably damaging Het
Tie1 A G 4: 118,486,228 V146A probably benign Het
Traf3ip1 G T 1: 91,527,639 E578D probably damaging Het
Trim23 A G 13: 104,188,155 Y247C probably damaging Het
Tsc2 A G 17: 24,607,755 W896R probably damaging Het
Vmn1r157 T C 7: 22,761,700 S2P probably benign Het
Xkr4 T A 1: 3,216,810 T386S probably damaging Het
Zdhhc24 T G 19: 4,878,861 V38G possibly damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACTCCTAAAGCAAGTGTCCTAG -3'
(R):5'- ACTTAGCAGTGAGGTAGGGC -3'

Sequencing Primer
(F):5'- AGTGTCCTAGCATCCAGAAATG -3'
(R):5'- CCTTAGGGAGCCAGAGGATGTC -3'
Posted On2019-06-26