Incidental Mutation 'R5261:D630045J12Rik'
ID401431
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 042830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5261 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38194620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 871 (L871Q)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably benign
Transcript: ENSMUST00000117556
AA Change: L730Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: L730Q

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably benign
Transcript: ENSMUST00000169256
AA Change: L871Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: L871Q

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,511,924 I227T probably benign Het
6820408C15Rik C G 2: 152,440,857 P211A probably damaging Het
Ambra1 G A 2: 91,885,606 V761M probably damaging Het
Amfr T A 8: 93,976,170 probably null Het
Asphd1 C A 7: 126,946,115 A357S probably benign Het
Brd3 C A 2: 27,463,919 Q60H probably damaging Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cep152 T A 2: 125,564,205 H1469L probably benign Het
Coro1a G T 7: 126,700,644 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Enpep T G 3: 129,305,426 D467A probably damaging Het
Extl2 G A 3: 116,027,364 A273T probably benign Het
Foxi3 T A 6: 70,960,516 F218Y probably damaging Het
Golga2 A G 2: 32,304,154 M521V probably benign Het
Gpr142 T A 11: 114,804,342 N44K probably damaging Het
Gtf2ird2 A G 5: 134,216,219 I440V probably benign Het
Gucy1b2 T A 14: 62,404,579 K698I probably damaging Het
Hspa1b T C 17: 34,959,007 M1V probably null Het
Ints9 T A 14: 65,008,072 Y260N probably benign Het
Khdc3 T G 9: 73,103,486 V182G possibly damaging Het
Ky A G 9: 102,537,599 probably null Het
Map2k1 T A 9: 64,191,561 I263F probably damaging Het
Olfr328 T C 11: 58,552,051 S63G probably benign Het
Olfr46 A C 7: 140,610,663 I166L probably benign Het
Olfr995 A G 2: 85,438,897 V87A probably benign Het
Otogl T A 10: 107,777,592 H2004L probably benign Het
Palmd T C 3: 116,923,360 H496R probably benign Het
Papolb C G 5: 142,529,654 R78P possibly damaging Het
Pcdh10 G A 3: 45,381,812 G854R probably damaging Het
Pdcd11 A G 19: 47,113,537 I1054V probably benign Het
Pik3ap1 A T 19: 41,376,106 L58Q probably damaging Het
Ppp2ca A G 11: 52,099,110 K21R probably benign Het
Prmt5 A C 14: 54,507,916 I598S probably damaging Het
Pycr1 T A 11: 120,641,224 I239F probably damaging Het
R3hdm2 C T 10: 127,498,416 R896C probably damaging Het
Rev3l C T 10: 39,846,729 P699S probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Sel1l A T 12: 91,824,884 M351K possibly damaging Het
Sesn2 A G 4: 132,499,306 L159P probably damaging Het
Slc35f4 T A 14: 49,303,489 probably benign Het
Slc3a1 C A 17: 85,051,975 N409K probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slco1c1 T C 6: 141,546,776 F246S probably damaging Het
Socs2 T G 10: 95,392,819 I190L unknown Het
Srsf1 T A 11: 88,047,858 I7N possibly damaging Het
Stox1 T A 10: 62,667,841 H145L probably damaging Het
Trap1 A T 16: 4,056,422 I243N probably damaging Het
Trav7-3 T C 14: 53,443,750 I83T probably benign Het
Tuft1 A T 3: 94,639,405 I42K possibly damaging Het
Umps A G 16: 33,966,974 V3A probably benign Het
Vim A C 2: 13,574,832 E134A probably null Het
Vmn1r28 C A 6: 58,265,539 H122Q probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vsig10l T A 7: 43,470,850 V760D probably damaging Het
Xrn1 A G 9: 96,045,543 D1460G probably benign Het
Zfp282 A G 6: 47,897,890 D343G probably damaging Het
Zfp35 A G 18: 24,003,721 H374R probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTGATCAAATAGACATCGGGAAC -3'
(R):5'- GTGTCATTCCAAGCAGCACAG -3'

Sequencing Primer
(F):5'- TATCACACACATATGGCGGCTTG -3'
(R):5'- GAGTCGATCTCTGACCCGTAC -3'
Posted On2016-07-06